Skip Navigation


Alcohol and Alcoholism Advance Access originally published online on April 20, 2006
Alcohol and Alcoholism 2006 41(4):364-367; doi:10.1093/alcalc/agl024
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
41/4/364    most recent
agl024v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (8)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by BÖNSCH, D.
Right arrow Articles by BLEICH, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by BÖNSCH, D.
Right arrow Articles by BLEICH, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?


© The Author 2006. Published by Oxford University Press on behalf of the Medical Council on Alcohol. All rights reserved

DIFFERENT ALLELE-DISTRIBUTION OF MTHFR 677 C -> T AND MTHFR –393 C -> A IN PATIENTS CLASSIFIED ACCORDING TO SUBTYPES OF LESCH'S TYPOLOGY

DOMINIKUS BÖNSCH*, KRISTINA BAYERLEIN, UDO REULBACH, ROLAND FISZER, THOMAS HILLEMACHER, WOLFGANG SPERLING, JOHANNES KORNHUBER and STEFAN BLEICH

Department of Psychiatry and Psychotherapy, Friedrich-Alexander-University of Erlangen-Nuremberg, Germany

* Author to whom correspondence should be addressed at: Department of Psychiatry and Psychotherapy, Friedrich-Alexander-University of Erlangen-Nuremberg, Schwabachanlage 6 91054 Erlangen, Germany. Tel.: +49 9131 8536362; Fax: +49 9131 8534105; E-mail: dominikus.boensch{at}psych.imed.uni-erlangen.de

(Received 3 November 2005; first review notified 15 December 2005; in revised form 13 Feburary 2006; accepted 27 Feburary 2006)


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Aims: The typology by Lesch distinguishes between four subtypes: type 1 (model of allergy), type 2 (model of anxiety or conflict), type 3 (alcohol as an antidepressant), and type 4 (alcohol as adaptation). Taking into account that alcohol dependence is associated with elevated homocysteine levels, this study was undertaken to investigate different MTHFR (methylenetetrahydrofolate reductase) genotypes related to homocysteine metabolism in patients with alcohol dependence who were classified according to Lesch's typology (LT). Subjects and methods: 134 non-abstinent chronic alcoholics (112 males, 22 females; mean age 44.2 (SD 8.9) years) were classified according to LT and divided into four groups: LT 1 (n = 26), LT 2 (n = 65), LT 3 (n = 58), and LT 4 (n = 18). Total plasma homocysteine levels and MTHFR genotypes –393, 677, and 1793 were determined. Results: We observed a significantly higher frequency of the thermolabile MTHFR 677 C->T variant (TT) in patients classified as subtype LT4 when compared with subtypes LT2 and LT3 (P = 0.005). Furthermore, for the MTHFR –393 C -> A-polymorphism, significantly more AC/AA variants were found in subtype LT4 (P = 0.034). No differences in allele-distribution were detected for MTHFR 1793. Conclusion: To our knowledge, this is the first study evaluating MTHFR genotypes in patients who were classified according to LT. Significantly different distributions of MTHFR 677 and –393 variants within Lesch Type 4 as compared with Types 2 and 3 hint at genetic determination of Lesch subtypes.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
It is difficult to pinpoint single characteristics associated with the vulnerability towards major psychiatric disorders including alcoholism. However, most of the previous studies did not include a subgroup typology of alcoholism. Lesch's typology (LT) is a well-established classification taking into account social, mental, and somatic factors (Lesch et al., 1990Go; Lesch and Walter, 1996Go). The typology differentiates four subtypes: type 1 (model of allergy) is characterized as patients with heavy alcohol withdrawals, who tend to use alcohol to weaken withdrawal symptoms. Patients of type 2 (model of anxiety or conflict) use alcohol as self-medication because of anxiolytic effects. In alcoholics of type 3 (alcohol as an antidepressant) the main characteristic is an affective disorder as the origin of alcohol abuse. Type 4 patients (alcohol as adaptation) show pre-morbid cerebral defects, behavioural disorders, and a high social burden. The decision tree developed in 1990 helps classify patients according to LT, which has been used in various studies (Kiefer and Barocka, 1999Go; Sperling et al., 2000Go; Lesch et al., 2001Go; Bleich et al., 2004Go).

There is growing evidence that chronic alcoholism, especially in non-abstinent patients, is associated with hyperhomocysteinaemia (Hultberg et al., 1993Go; Bleich et al., 2000aGo; de la Vega et al., 2001Go). The reasons for the increase of plasma homocysteine levels and its significant correlation with blood alcohol concentration, regardless of whether beer, wine, or spirits have been consumed (Bleich et al., 2000bGo; Bleich et al., 2001Go), are most probably complex ones in alcohol-dependent patients. In the metabolism, homocysteine is either transsulphurated into cystathionine or it is remethylated to methionine by methionine synthase (MS). In actively drinking alcoholics an impairment of remethylation of homocysteine is brought about on account of a dysfunction of MS, due to an alcohol-induced vitamin deficiency (folic acid, vitamin B12), as well as a direct inhibition of MS due to acetaldehyde, the product of oxidative degradation of alcohol (Kenyon et al., 1998Go).

Methylenetetrahydrofolate reductase (MTHFR) synthesizes 5-methyltetrahydrofolate, the major carbon donor in the remethylation of homocysteine to methionine. A cytosine-to-thymine (C->T) mutation at nucleotide 677 causes the substitution of valine for alanine at amino acid 223 and renders the enzyme thermolabile. So it becomes less efficient (<50% at 37°C) and may lead to raised levels of homocysteine (Kang et al., 1988Go). The infrequent (10–17%) homozygote with the MTHFR thermolabile (TT) polymorphism (Brattstrom et al., 1998Go) limits the transformation of homocysteine into methionine by MS and increases the levels of the former, especially when serum folate levels are low. Several other polymorphisms have been described including 1793 G -> A (Rady et al., 2002Go) and –393 C -> A (Wakutani et al., 2004Go), which results in a putative amino acid substitution from aspartate to glutamate at codon 2 of the MTHFR2 polypeptide (A2G/MTHFR2).

Therefore, the aim of this study was to evaluate MTHFR genotypes in different subtypes according to the typology of Lesch.


    SUBJECTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The study was approved by the Ethics Committee of the Medical Faculty of the University of Erlangen-Nuremberg and written informed consent was obtained from all patients before participating in any part of the study. The present prospective open case control study with a naturalistic design included 134 non-abstinent chronic alcoholics, 112 males and 22 females, (mean: 44.2 years, SD 8.9) from the FARS (Franconian Addiction Research Studies) (Bleich et al., 2005Go). Study design, laboratory methods, and nutritional assessments were performed with minor modifications as previously described (Bleich et al., 2000aGo). Briefly, all patients were active drinkers and had an established diagnosis of alcohol dependence according to the Diagnostic Statistical Manual for Mental Disorders (DSM-IV) with a history of alcohol consumption ranging from 6 to 47 years (mean: 19.2 years). Mean daily ethanol intake was 208 g (SD 141), this quantity being derived according to Cravo et al. (1996Go). Patients with any other known risk factors for hyperhomocysteineamia such as nutritional status, medication (i.e. methotrexate), endocrinological conditions, and other diseases (i.e. thromboembolic and cardiovascular diseases) as well as patients with any other psychiatric comorbidity were not included in the study. Patients were divided into 4 groups (Type 1–4) according to LT (computerized allocation according to the decision tree; Lesch et al., 1990Go) prior to genetic analysis.

In order to compare the groups as accurately as possible, Caucasian controls were matched to Caucasian cases, having no disorder meeting DSM-IV criteria, by age.

Fasting total homocysteine in plasma (reference value < 15 µmol/l) was measured by an enzyme-linked immunosorbent assay (Axis® Homocysteine EIA, Germany/Norway, IBL-No.: AX 513 01) according to Frantzen et al. (1998)Go. Carbohydrate-deficient transferrin (CDT) at admission and after 10 days was assessed to identify chronic heavy alcohol consumption and monitoring abstinence. The %CDT turbidimetric immunoassay (reference value < 2.6%, Axis-Shield®, Norway) with assessment of the relative amount of CDT (primarily the asialo, monosialo, and disialo transferrin isoforms) in proportion to total transferrin was performed (Helander et al., 2001Go). Blood samples of vitamins (folate, vitamin B12) and blood alcohol concentrations (BAC) were also taken at admission. All fasting blood samples were promptly centrifuged following collection. Plasma was stored at –80°C. Vitamin B12 and serum-folate concentrations were measured by chemiluminescence using Chiron kits (Chiron Diagnostics Corporation/Fernwald, Germany) on a Chiron ACS: 180 automated analyser.

MTHFR polymorphisms were genotyped as described previously (Bleich et al., 2002Go): Briefly, DNA extraction was performed from EDTA blood using Qiagen DNA blood mini kit. PCR was done as published previously using following primerpairs:
Name

Primer 5'–3'

Length (bp)

Restriction-enzyme

677-F TGAAGGAGAAGGTGTCTGCGGG 198 HinfI
677-R AGGACGGTGCGGTGAGAGTG
393-F TGAACTTGGGTCTGGCTATTTT 797 ApaLI
393-R ACACATCAAGACACCTGAGTGG
1793-F CTCTGTGTGTGTGTGCATGTGTGCG 310 BsrbI
1793-R GGGACAGGAGTGGCTCCAACGCAGG

Each 25 µl of PCR mixture contained 10 ng DNA, 1x PCR buffer (50 mM KCl, 10 mM Tris–HCl, pH 9.0), 1.5 mM MgCl2, 0.2 mM each dNTP, 0.5 mM each primer, and 1 unit of Taq DNA polymerase. The reaction mixture was initially denatured at 95°C for 3 min. PCR was performed in 35 cycles of 95°C for 30 s, 65°C for 30 s, and 72°C for 45 s. The PCR was completed by a final extension cycle at 72°C for 7 min. Each PCR product (10 µl) was digested with 10 units of the corresponding restriction enzyme at 37°C for 3 h. After electrophoresis through 2% agarose gel, the digestion products were visualized by staining with 1 µg/ml of ethidium bromide.

Statistical analysis: Comparisons were made using the Kruskal–Wallis test for independent samples. The differences of the distribution of the genotypes were calculated with the Chi-squared statistic. All statistical tests were calculated with the statistical software package SPSS12.01 (SPSS Inc., Chicago, IL). The significance level was set at {alpha} = 0.05.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
No significant differences among the four Lesch types with respect to age, BAC, CDT (%), lifetime drinking (LD), years of drinking (YD), and vitamin (folate, B12) levels were found. (Kruskal–Wallis-test, 0.08 < {chi}2 < 7.35, 0.06 < P < 1.0; for descriptive data see Table 1). (Table 1). Furthermore, with respect to plasma homocysteine levels, no significant differences were identified. Patients were genotyped for MTHFR variants –393, 677, and 1793.


View this table:
[in this window]
[in a new window]
 
Table 1. Comparison of variables of actively drinking alcoholic patients classified as Lesch Type (LT) 1, 2, 3, and 4

 
In patients with chronic alcoholism, allele frequencies of MTHFR genotypes did not differ from controls in the polymorphisms MTHFR 677 and MTHFR 1793 (Table 2). Within the patients, distribution of CT and TT genotype of MTHFR 677 showed highly significant differences according to Lesch Types ({chi}2 = 18.8, P = 0.005) (Table 3). The ‘unfavourable’ TT variant shows an equal frequency of ~12% in our control-sample, and the sample of alcohol-dependent patients. However, within Lesch Type 4, a frequency of 33.3% was found. On the contrary, the frequency was only 3.1% in Type 2 and 5.4% in Type 3.


View this table:
[in this window]
[in a new window]
 
Table 2. Comparison of allele frequencies in alcohol-dependent patients and healthy controls

 

View this table:
[in this window]
[in a new window]
 
Table 3. Allele frequencies of MTHFR variants in alcohol-dependent patients classified as Lesch Type (LT) 1, 2, 3, and 4

 
Also for MTHFR –393, homozygous and heterozygous variants CA and AA differed significantly within the groups ({chi}2 = 8.7, P = 0.034): As in 677, the highest frequency of the ‘unfavourable’ allele CA was found in Lesch Type 4 with 40% instead of the expected 20%. Just as well, the frequency in Lesch Type 2 (13.6%) and Lesch Type 3 (7.1%) was low.

No differences could be identified for MTHFR 1793 within the different Lesch Types ({chi}2 = 1.03, P = 0.793).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To our knowledge, this is the first study evaluating MTHFR genotypes in patients classified according to LT. Genotypes leading to less efficient MTHFR-variants were found in subtype 4, and to a lower extent also in subtype 1, but not in subtypes 2 and 3. We did not find any correlation between MTHFR genotype and homocysteine plasma levels. Several studies have demonstrated that only the MTHFR 677 C -> T polymorphism has been weakly associated with plasma homocysteine levels, and probably the level is influenced by the nicotinamide N-methyltransferase gene (NNMT) (Souto et al., 2005Go). As homocysteine was found elevated in patients with seizures in LT1 only (Bleich et al., 2004Go), the normal levels in the entire group may be because of several reasons: (I) The influence of MTHFR 677 C -> T polymorphism is weak compared with other genetic determinants like NNMT. (II) Inflammatory disease or malnutrition may lead to lowered homocysteine levels. For the second argument, no hints could be found in our sample, as none of the probands was malnourished, and blood parameters like C-reactive protein or RBCC were equally distributed in all groups. So the effect of MTHFR 677 C -> T polymorphism may be altered dynamics in homocysteine metabolism rather than increased levels.

At present, it cannot be excluded that polymorphisms within the MTHFR gene also influence homocysteine related neurotransmitters like taurine. Taurine itself restores the secretion and expression of extracellular superoxide dismutase by ameliorating endoplasmatic reticulum stress induced by homocysteine (Nonaka et al., 2001Go). In patients with severe MTHFR deficiency, even cerebral demyelination and spinal cord degeneration were described (Hyland et al., 1988Go), indicating influences on several other systems.

The proven association between alcoholism and raised plasma levels of homocysteine might account for different pathophysiological consequences such as alcohol-related brain atrophy (Bleich et al., 2003Go) and short-term cognitive deficits during alcohol withdrawal (Wilhelm et al., 2005Go). Moreover, it has been shown that alcoholism-associated hyperhomocysteinaemia predicts first-onset alcohol withdrawal seizures (Bleich et al., 2000cGo). Furthermore, patients with an active drinking pattern and with a history of alcohol withdrawal seizures were also found to have significantly higher raised homocysteine concentrations than actively drinking alcoholics without a history of seizures (Bayerlein et al., 2005Go). This was also shown in Lesch-Type 1 patients, who were linked to their higher risk for withdrawal seizures (Bleich et al., 2004Go). The finding of an elevated frequency of MTHFR 677 C -> T and –393 C -> A polymorphisms in the group of Lesch-Type 1 patients (and the small group of Type 4), which have been linked to elevated homocysteine and higher risk for withdrawal seizures, may partially explain these prior findings and hint at an associated mechanism.

Our findings may suggest a genetic determination of Lesch subtypes: In our small sample less efficient variants of MTHFR are found in Lesch Types 1 and 4 compared with Types 2 and 3. Further studies will be necessary to evaluate effects of MTHFR polymorphisms in a larger sample.


    ACKNOWLEDGEMENTS
 
We gratefully acknowledge the support by a grant (S.B.) from Axis Shield, Norway (CT-H2003). None of the authors had a financial or personal conflict of interest. The sponsor had no role in study design, data collection, data analysis, data interpretation, or writing of the report.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bayerlein, K., Hillemacher, T., Reulbach, U. et al. (2005) Alcoholism associated hyper-homocysteinemia and previous withdrawal seizures. Biological Psychiatry 57, 1590–1593.[CrossRef][Web of Science][Medline]

Bleich, S., Degner, D., Wiltfang, J. et al. (2000a) Elevated homocysteine levels in alcohol withdrawal. Alcohol and Alcoholism 35, 351–354.[Abstract/Free Full Text]

Bleich, S., Degner, D., Kropp, S. et al. (2000b) Red wine, spirits, beer and serum homocysteine. Lancet 356, 512.[Web of Science][Medline]

Bleich, S., Degner, D., Bandelow, B. et al. (2000c) Homocysteine is a predictor of alcohol withdrawal seizures. Neuroreport 11, 2749–2752.[Web of Science][Medline]

Bleich, S., Bleich, K., Kropp, S. et al. (2001) Moderate alcohol consumption in social drinkers raises plasma homocysteine levels: a contradiction to the 'French Paradox? Alcohol and Alcoholism 36, 189–192.[Abstract/Free Full Text]

Bleich, S., Jünemann, A., von Ahsen, N. et al. (2002) Homocysteine and risk of open-angle glaucoma. Journal of Neural Transmission 109, 1499–1504.[CrossRef][Web of Science][Medline]

Bleich, S., Bandelow, B., Javaheripour, K. et al. (2003) Hyperhomocysteinemia as a new risk factor for brain shrinkage in patients with alcoholism. Neuroscience Letters 335, 179–182.[CrossRef][Web of Science][Medline]

Bleich, S., Bayerlein, K., Reulbach, U. et al. (2004) Homocysteine levels in patients classified according to Lesch's typology. Alcohol and Alcoholism 39, 493–498.[Abstract/Free Full Text]

Bleich, S., Carl, M., Bayerlein, K. et al. (2005) Evidence of increased homocysteine levels in alcoholism: the Franconian alcoholism research studies (FARS). Alcohol: Clinical and Experimental Research 29, 334–336.[CrossRef][Web of Science][Medline]

Brattstrom, L., Zhang, Y., Hurtig, M. et al. (1998) A common methylenetetrahydrofolate reductase gene mutation and longevity. Atherosclerosis 141, 315–319.[CrossRef][Web of Science][Medline]

Cravo, M. L., Gloria, L. M., Selhub, J. et al. (1996) Hyperhomocysteinemia in chronic alcoholism: correlation with folate, vitamin B-12, and vitamin B-6 status. American Journal of Clinical Nutrition 63, 220–224.[Abstract/Free Full Text]

de la Vega, M. J., Santolaria, F., Gonzalez-Reimers, E. et al. (2001) High prevalence of hyperhomocysteinemia in chronic alcoholism: the importance of the thermolabile form of the enzyme methylenetetrahydrofolate reductase (MTHFR). Alcohol 25, 59–67.[CrossRef][Web of Science][Medline]

Frantzen, F., Faaren, A. L., Alfheim, I. et al. (1998) Enzyme conversion immunoassay for determining total homocysteine in plasma or serum. Clinical Chemistry 44, 311–316.[Abstract/Free Full Text]

Helander, A., Fors, M. and Zakrisson, B. (2001) Study of Axis-Shield new %CDT immunoassay for quantification of carbohydrate-deficient transferrin (CDT) in serum. Alcohol and Alcoholism 36, 406–412.[Abstract/Free Full Text]

Hultberg, B., Berglund, M., Andersson, A. et al. (1993) Elevated plasma homocysteine in alcoholics. Alcoholism: Clinical and Experimental Research 17, 687–689.[CrossRef][Web of Science][Medline]

Hyland, K., Smith, I., Bottiglieri, T. et al. (1988) Demyelination and decreased S-adenosylmethionine in 5,10-methylenetetrahydrofolate reductase deficiency. Neurology 38, 459–462.[Abstract/Free Full Text]

Kang, S. S., Wong, P. W., Zhou, J. M. et al. (1988) Thermolabile methylenetetrahydrofolate reductase in patients with coronary artery disease. Metabolism 37, 611–613.[CrossRef][Web of Science][Medline]

Kenyon, S. H., Nicolaou, A. and Gibbons, W. A. (1998) The effect of ethanol and its metabolites upon methionine synthase activity in vitro. Alcohol 15, 305–309.[CrossRef][Web of Science][Medline]

Kiefer, F. and Barocka, A. (1999) Secondary depression in weaned alcoholics: Implications of Lesch's typology of chronic alcoholism. Alcohol and Alcoholism 34, 916–917.[Free Full Text]

Lesch, O. M. and Walter, H. (1996) Subtypes of alcoholism and their role in therapy. Alcohol and Alcoholism 31, 63–67.[Medline]

Lesch, O. M., Kefer, J., Lentner, S. et al. (1990) Diagnosis of chronic alcoholism - classificatory problems. Psychopathology 23, 88–96.[Web of Science][Medline]

Lesch, O. M., Riegler, A., Gutierrez, K. et al. (2001) The European Acamprosate Trials: conclusions for research and therapy. Journal of Biomedical Science 8, 89–95.[Web of Science][Medline]

Nonaka, H., Tsujino, T., Watari, Y. et al. (2001) Taurine prevents the decrease in expression and secretion of extracellular superoxide dismutase induced by homocysteine: amelioration of homocysteine-induced endoplasmic reticulum stress by taurine. Circulation 104, 1165–1170.[Abstract/Free Full Text]

Rady, P. L., Szucs, S., Grady, J. et al. (2002) Genetic polymorphisms of methylenetetrahydrofolate reductase (MTHFR) and methionine synthase reductase (MTRR) in ethnic populations in Texas; a report of a novel MTHFR polymorphic site, G1793A. American Journal of Medical Genetics 107, 162–168.[CrossRef][Web of Science][Medline]

Souto, J. C., Blanco-Vaca, F., Soria, J. M. et al. (2005) A genomewide exploration suggests a new candidate gene at chromosome 11q23 as the major determinant of plasma homocysteine levels: results from the GAIT project. American Journal of Human Genetics 76, 925–933.[CrossRef][Web of Science][Medline]

Sperling, W., Frank, H., Martus, P. et al. (2000) The concept of abnormal hemispheric organization in addiction research. Alcohol and Alcoholism 35, 394–399.[Abstract/Free Full Text]

Wakutani, Y., Kowa, H., Kusumi, M. et al. (2004) The regulatory region polymorphisms of the MTHFR gene are not associated with Alzheimer's disease. Dementia and Geriatric Cognitive Disorders 17, 147–150.[Medline]

Wilhelm, J., Bayerlein, K., Hillemacher, T. et al. (2006) Short-term cognition deficits during early alcohol withdrawal are associated with elevated plasma homocysteine levels in patients with alcoholism. Journal of Neural Transmission, 113,357–363.[CrossRef][Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Alcohol AlcoholHome page
M. d. P. Zago-Gomes and E. M. Nakamura-Palacios
Cognitive Components of Frontal Lobe Function in Alcoholics Classified According to Lesch's Typology
Alcohol Alcohol., September 1, 2009; 44(5): 449 - 457.
[Abstract] [Full Text] [PDF]


Home page
Alcohol AlcoholHome page
T. Hillemacher and S. Bleich
Neurobiology and Treatment in Alcoholism--Recent Findings Regarding Lesch's Typology of Alcohol Dependence
Alcohol Alcohol., March 13, 2008; (2008) agn016v1.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
41/4/364    most recent
agl024v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (8)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by BÖNSCH, D.
Right arrow Articles by BLEICH, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by BÖNSCH, D.
Right arrow Articles by BLEICH, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?