Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Herman, A. I.
Right arrow Articles by Depetrillo, P. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Herman, A. I.
Right arrow Articles by Depetrillo, P. B.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Alcohol and Alcoholism Vol. 38, No. 5, pp. 446-449, 2003
© 2003 Medical Council on Alcohol


RAPID COMMUNICATION

SEROTONIN TRANSPORTER PROMOTER POLYMORPHISM AND DIFFERENCES IN ALCOHOL CONSUMPTION BEHAVIOUR IN A COLLEGE STUDENT POPULATION

Aryeh I. Herman, John W. Philbeck1, Nicholas L. Vasilopoulos1 and Paolo B. Depetrillo*

Unit of Clinical and Biochemical Pharmacology, Laboratory of Clinical Studies, Intramural Research Program, National Institutes on Alcohol Abuse and Alcoholism, National Institutes of Health, Bethesda, MD, and
1 Department of Psychology, George Washington University, Washington, DC, USA

(Received 16 May 2003; first review notified 5 June 2003; in revised form 12 June 2003; accepted 16 June 2003)


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Aims and methods: In the present study, differences in alcohol consumption behaviour associated with the presence of the short variant (S) of the serotonin transporter promoter polymorphism (5-HTTLPR) was investigated in a Caucasian subset (n = 204) of 268 college students. Results: Students who were homozygous for the S allele were more likely to engage in binge-drinking behaviour, drank more alcohol per occasion, and reported drinking to get drunk more often. Conclusions: In this Caucasian sample, the 5-HTTLPR strongly influences alcohol consumption in late pubescence.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Binge drinking is a specific type of alcohol misuse that is a major public health concern affecting more than 6 million full-time college students in the USA (Wechsler et al., 1995Go), spurring a major initiative led by the National Institute on Alcohol Abuse and Alcoholism aimed at understanding the scope of the problem and developing prevention strategies (Goldman et al., 2002Go). Genetic factors influence the risk for engaging in this behaviour, but the majority of studies have addressed the modifying influences of the ALDH2*2 allele on alcohol consumption in Asians, Caucasians and Ashkenazic Jewish Americans (Luczak et al., 2001Go; Shea et al., 2001Go). We surmised that functional differences in serotonergic function conferred by the serotonin transporter (5-HTT) protein promoter polymorphism (5-HTTLPR) might be associated with differences in alcohol consumption behaviours in college students, an area that has not yet been investigated.

The most common insertion deletion polymorphism in the promoter region of the human 5-HTT gene (SLC6A4) gives rise to a biallelic polymorphism designated long allele (L) and short allele (S). The S variant is associated with lower expression of 5-HTT sites and reduced efficiency of 5-HT re-uptake (Lesch et al., 1996Go; Whale et al., 2000Go). A higher frequency of S was associated with higher ethanol tolerance in young adults (<26 years), suggesting that self-regulation of alcohol intake may be influenced by the presence of this allele (Turker et al., 1998Go). A higher frequency of S homozygotes was present in a sub-group of adult alcoholics who exhibited an increased frequency of binge drinking (Matsushita et al., 2001Go).

In the present study, we genotyped college students for the 5-HTTLPR and examined the possible association of the S variant with differences in alcohol use behaviours, determined from a set of responses to the College Alcohol Study. We hypothesized that individuals carrying at least one S allele of the 5-HTTLPR would engage in more frequent binge drinking and that it was likely that the S allele would act in a recessive fashion.


    SUBJECTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The study was approved by the local Institutional Review Board. The population sample was drawn from college students enrolled in a medium-size undergraduate institution. A total of 262 participants completed the study, of which 256 could be stratified as Caucasian, African-American, or Asian, and of which 6 were members of other ethnic groups. Answers to the following survey questions were used in the analyses. Answers to the questions were scored using ordinal scales. The magnitudes associated with the possible responses, which were used to generate graphic and statistical results, are shown within parentheses preceding each answer. This information did not appear on the questionnaires completed by the respondents.

  1. ‘Think back over the last 2 weeks. How many times have you had five (for male students) four (for female students) or more drinks in a row? (0) None; (1) Once; (2) Twice; (3) 3–5 times; (4) 6–9 times; (5) 10 or more times?’
  2. ‘On how many occasions have you had a drink of alcohol in the past 30 days? (0) Did not drink in the past 30 days; (1) 1–2 occasions; (2) 3–5 occasions; (3) 6–9 occasions; (4) 10–19 occasions; (5) 20–39 occasions; (6) 40 or more occasions?’
  3. ‘In the past 30 days, on those occasions when you drank alcohol, how many drinks did you usually have? (0) Did not drink in the past 30 days; (1) 1 drink; (2) 2 drinks; (3) 3 drinks; (4) 4 drinks; (5) 5 drinks; (6) 6 drinks; (7) 7 drinks; (8) 8 drinks; (9) 9 or more drinks?’
  4. ‘On how many occasions did you drink to get drunk in the past 30 days? (0) Not at all; (1) 1–2 occasions; (2) 3–5 occasions; (3) 6–9 occasions; (4) 10–19 occasions; (5) 20–39 occasions?’

A drink of alcohol was defined as a 12-ounce can or bottle of beer, a 4-ounce glass of wine, a 12-ounce bottle or can of wine cooler or a shot of liquor straight or in a mixed drink.

Genetic analysis
DNA was isolated from saliva following the protocol from the Puregene Genomic DNA Purification kit (Minneapolis, MN, USA). Primers used: 5' Texas Red labelled (Sigma Genosys, The Woodlands, TX, USA), sense, 5' to 3' ATGCCAGCACCTAACCCCTAATGTCC; SLC6A4.for; antisense 5' to 3' GAGGGACTGAGCTGGACAACCACG; SLC6A4.rev. PCR was performed using the Roche GC-Rich kit (catalogue no. 2 140 305; Roche, Indianapolis, IN, USA). Amplification buffer contained genomic DNA (2.5–10 ng in 0.25 µL), 0.375 µm forward and reverse primers, carried out in a 50-µL reaction tube containing 0.2 mm of DNTP, 0.4 mm Tris-HCl, pH 8.0, 2 mm KCl and 1 m GC-rich resolution solution with 2 U enzyme mix. The PCR was hot started and run for 40 cycles (30 s at 95°C; 20 s at 64°C; 25 s at 72°C) in a Perkin-Elmer GeneAmp 9600 PCR System (Perkin-Elmer, Wellesley, MA, USA). Expected amplicon length was 470 bp for the short allele and 514 bp for the long allele. The PCR products were sequenced and matched the expected amplicon sequences.

Statistical analyses
To avoid issues of population stratification, only data from the Caucasian (n = 204) sub-population was analyzed. Statistical procedures were performed in JMP 5.0 (SAS Institute, Cary, NC, USA). Only outcome variable III was approximately normally distributed, Kolmogorov–Smirnov goodness-of-fit test (P > 0.999). An F-test for homoscedasticity confirmed equality of variances: P-values for LL vs. LS, LL vs. SS, and LS vs. SS being 0.90, 0.73, and 0.63 respectively. We therefore employed a parametric ordinary least-squared linear regression model (ANOVA) to compare and contrast the mean differences between genotypes for responses to question III. A mixed stepwise regression procedure was employed to construct the linear regression model for III, and logistic regression models for I, II and IV, with genotype-, sex- and age-associated regressor terms, with P <= 0.25 to enter and P >= 0.10 to remove. Genotype (LL, LS, SS), age and sex (M, F) along with higher order interaction regressor terms were considered.

The responses obtained from the answers to survey questions I, II and IV were analyzed using a multinomial logistic regression to determine whether genotype group influenced the magnitude of the response to the questions. A stepwise approach was used to avoid biasing the results by fitting the logistic curves to a predetermined model assuming a dominant, recessive, or additive effect for each of the genotypes. The best fit models are reported for answers to survey question I (binge drinking) and (drinking to get drunk). The results of logistic regression for question II (number of occasions) are not reported as no significant genotype effects were found. The model parameters of the best fit logistic regressions are of the form: P(Yes, Response <= X) = 1 / {1 + exp (- Intercept(X) – Genotype(LL + LS or SS)}; where Intercept(X) is associated with Response level X, and the Genotype(LL + LS or SS) is the parameter associated with the genotype group. The individual probabilities for a particular response are computed by taking the difference of the successive cumulative probabilities. As these represent cumulative probabilities, the probability for the highest response level is simply P(Yes, 5) = 1 – P(Yes, 4). Data were fitted to the logistic regressions using the method of maximum likelihood.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Genotypes and age are shown in Table 1Go. There were no differences in age between the men and the women (P = 0.34, unpaired t-test) for the Caucasian subset which was analyzed. Population frequencies for the L and S variants were 53 and 47%, respectively. Genotypes were distributed in accordance with Hardy–Weinberg equilibrium, ({chi}2 = 0.996; d.f. = 2; P = 0.61), similar to the previously reported L and S allele frequencies of 57 and 43%, respectively, in 505 healthy Caucasians (Lesch et al., 1996Go). Hardy–Weinberg equilibrium was maintained across sex: for female students, L and S allele frequencies were 53 and 47% ({chi}2 = 0.379; d.f. = 2; P = 0.83) and for male students 56 and 44% ({chi}2 = 0.997; d.f. = 2; P = 0.61) respectively. Delbruck described a novel extra long allelic variant (Delbruck et al., 1997Go) which tends to be exclusively present in individuals of African origin. We did not note any novel alleles.


View this table:
[in this window]
[in a new window]
 
Table 1. Sex, age and genotype of students
 
We report summary data for questions I, II and IV in Fig. 1Go. The results of the best-fit models for the logistic regressions are shown in Table 2Go. For response variables I and IV, the results of the logistic regressions are depicted in Fig. 2Go. Neither age nor sex were retained in the final logistic fit for both I and IV, and the recessive model (LL + LS vs. SS) provided the best fit. The logistic regressions for II resulted in a best-model fit with P = 0.2718, therefore no other results are reported. Results of the linear regression model for III are shown in Table 3Go. In this case, regressor terms for all genotype groups were found to explain a significant portion of the variance, suggesting a mixed additive/recessive effect of the S allele on the number of drinks consumed per drinking occasion.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 1. Association of 5-HTTLPR genotype and means of survey responses in a study on serotonin transporter promoter polymorphism and differences in alcohol consumption behaviour in a college student population. Number of occasions of binge drinking in past 2 weeks (BD, question I); number of occasions of alcohol use in the past 30 days (NOAU, question II); number of occasions of drinking to get drunk in the past 30 days (NODD, question IV) are given as means ± SEM (bars). There was a significant difference in the magnitude of the response to questions I and IV between (LL + LS) and SS. The significance levels for the differences were obtained from the logistic regressions, and are equal to the genotype group effects shown in Table 2Go. There were no significant differences in the magnitude of the response to question II between genotype groups.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Results of best-fit logistic regression modelsa
 


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 2. Probability ratios of ‘Yes’ responses to the different levels of the survey questions. Ratios are related to binge drinking (top) and drinking to get drunk (bottom). The ratio is computed as the probability of a ‘Yes’ response at each level, shown on the x-axis, for individuals with an SS genotype, P(SS, ‘Yes’) divided by the probability of a ‘Yes’ response for individuals with LL or LS genotypes P(LL + LS), ‘Yes’). The probability values and associated errors were computed from the logistic regressions. A ratio of one implies an equal chance for a ‘Yes’ response. The means± SEM (bars) are shown.

 

View this table:
[in this window]
[in a new window]
 
Table 3. Analysis of variance results for number of drinks per occasion
 
Aggregate results for mean number of drinks per occasion (III) grouped by genotype are shown in Fig. 3Go. For LL vs. SS, LL vs. (LS + SS) and LS vs. SS, P = (uncorrected, corrected by Bonferroni-Holm): (0.005, 0.015), (0.016, 0.032) and (0.072, 0.072). Male students consumed more drinks per occasion than did female students, 4.60 ± 0.37 vs. 3.72 ± 0.14 (P = 0.006). There was a significant effect of age, with a decrease of approximately one drink per occasion every 3 years for the sample population. None of the higher-order interactive effects were retained in the final model: genotype x sex (P = 0.5574), genotype x age (P = 0.4652), genotype x sex x age (P = 0.3914). The power to detect meaningful effects at an {alpha} = 0.05 for group effects was as follows: genotype (0.71), sex (0.79), age (0.92).



View larger version (9K):
[in this window]
[in a new window]
 
Fig. 3. Allelic dose-response for number of drinks per occasion and genotype. The mean of the number of drinks of alcohol consumed per occasion [± SEM (bars)] is represented on the y-axis, and the 5-HTTLPR genotype is indicated on the x-axis.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The findings of the present study reveal a significant association of the 5-HTTLPR polymorphism with increased alcohol consumption behaviour in Caucasian college students. Students homozygous for the short allele (S) of the 5-HTTLPR engaged in a higher frequency of binge drinking, drank more often to get drunk, and consumed an increased number of alcoholic drinks during drinking occasions compared to L homozygotes or heterozygotes. The long variant of the 5-HTTLPR exerted an additive/recessive effect on the number of drinks consumed per occasion (Fig. 3Go). The frequency of alcohol consumption was not different between genotype groups.

Individuals homozygous for the S variant of the 5-HTTLPR had a higher risk of purposefully engaging in alcohol consumption to induce intoxication. One explanation for this finding might be that individuals homozygous for the S variant exhibit higher levels of baseline anxiety (Lesch et al., 1996Go; Melke et al., 2001Go), using alcohol as an anxiolytic. Heavy drinking as a tension reducing strategy was recently described in a college population (Rutledge and Sher, 2001Go).

There are limitations of the current study which affect the generalizability of the findings. Other unknown positive and negative genetic and environmental modulators of alcohol consumption behaviour may have been present. However, one of the strongest findings is the allelic dose–response, as shown in Fig. 3Go, fulfilling one of the main criteria outlined by Hill (1965)Go implying causation rather than simple association. Our results support a biologically derived difference in alcohol consumption.

In conclusion, the results of this study suggest that the 5-HTTLPR genotype strongly influences alcohol drinking behaviour in this sample of college students, increasing our understanding of biological risk factors which may play a role in determining maladaptive patterns of alcohol consumption. Based on these results, further study of the influence of the 5-HTTLPR on alcohol consumption behaviours in other populations is under way.


    ACKNOWLEDGEMENTS
 
We thank A. Patel and J. Sternfeld for expert technical assistance.


    FOOTNOTES
 
* Author to whom correspondence should be addressed at: NIH 10/3C103, 10 Center Drive MSC 1256, Bethesda, MD, 20892-1256, USA. Tel.: 301 496 9420; Fax: 301 402 0445; E-mail:pbdp{at}helix.nih.gov Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 SUBJECTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Delbruck, S. J., Wendel, B., Grunewald, I., Sander, T., Morris-Rosendahl, D., Crocq, M. A., Berrettini, W. H. and Hoehe, M. R. (1997) A novel allelic variant of the human serotonin transporter gene regulatory polymorphism. Cytogenetics and Cell Genetics 79, 214–220.[Web of Science][Medline]

Goldman M. S., Boyd G. M. and Faden V (eds) (2002) College Drinking, What It Is, and What To Do about It: A Review of the State of the Science. Journal of Studies on Alcohol 63 (Suppl. 14), 1–250.

Hill, B. (1965) The environment and disease: Association or causation? Proceedings of the Royal Society of Medicine 58, 295–299.[Web of Science][Medline]

Lesch, K. P., Bengel, D., Heils, A., Sabol, S. Z., Greenberg, B. D., Petri, S., Benjamin, J., Muller, C. R., Hamer, D. H. and Murphy, D. L. (1996) Association of anxiety-related traits with polymorphism in the serotonin transporter gene regulatory region. Science 29, 1527–1531.

Luczak, S. E., Wall, T. L., Shea, S. H., Byun, S. M. and Carr, L. G. (2001) Binge drinking in Chinese, Korean, and White college students: genetic and ethnic group differences. Addictive Behaviours 15, 306–309.[CrossRef]

Matsushita, S., Yoshino, A., Murayama, M., Kimura, M., Muramatsu, T. and Higuchi, S. (2001) Association study of serotonin transporter gene regulatory region polymorphism and alcoholism. American Journal of Medical Genetics 105, 446–450.[CrossRef][Web of Science][Medline]

Melke, J., Landen, M., Baghei, F., Rosmond, R., Holm, G., Bjorntorp, P., Westberg, L., Hellstrand, M. and Eriksson, E. (2001) Serotonin transporter gene polymorphisms are associated with anxiety-related personality traits in women. American Journal of Medical Genetics 105, 458–463.[CrossRef][Web of Science][Medline]

Rutledge, P. C. and Sher, K. J. (2001) Heavy drinking from the freshman year into early young adulthood: the roles of stress, tension-reduction drinking motives, gender and personality. Journal of Studies on Alcohol 62, 457–466.[Web of Science][Medline]

Shea, S. H., Wall, T. L., Carr, L. G. and Li, T.-K. (2001) ADH2 and alcohol-related phenotypes in Ashkenazic Jewish American college students. Behavioral Genetics 31, 231–239.[CrossRef][Web of Science][Medline]

Turker, T., Sodmann, R., Goebel, U., Jatzke, S., Knapp, M., Lesch, K. P., Schuster, R., Schutz, H., Weiler, G. and Stober, G. (1998) High ethanol tolerance in young adults is associated with the low-activity variant of the promoter of the human serotonin transporter gene. Neuroscience Letters 248, 147–150.[CrossRef][Web of Science][Medline]

Wechsler, H., Dowdall, G. W., Davenport, A. and Castillo, S. (1995) Correlates of college student binge drinking. American Journal of Public Health 85, 921–926.[Abstract/Free Full Text]

Whale, R., Quested, D. J., Laver, D., Harrison, P. J. and Cowen, P. J. (2000) Serotonin transporter (5-HTT) promoter genotype may influence the prolactin response to clomipramine. Psychopharmacology (Berlin) 150, 120–122.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Herman, A. I.
Right arrow Articles by Depetrillo, P. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Herman, A. I.
Right arrow Articles by Depetrillo, P. B.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?