Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (9)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Eriksson, M.
Right arrow Articles by Balldin, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Eriksson, M.
Right arrow Articles by Balldin, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Alcohol and Alcoholism Vol. 35, No. 5, pp. 493-498, 2000
© 2000 Medical Council on Alcoholism

ALCOHOLICS WITH THE DOPAMINE RECEPTOR DRD2 A1 ALLELE HAVE LOWER PLATELET MONOAMINE OXIDASE-B ACTIVITY THAN THOSE WITH THE A2 ALLELE: A PRELIMINARY STUDY

Matts Eriksson, Ulf Berggren, Kaj Blennow, Claudia Fahlke1, Jan-Erik Månsson and Jan Balldin*

Institute of Clinical Neuroscience, Department of Psychiatry and Neurochemistry, Sahlgren University Hospital/Mölndal, Göteborg University, SE-431 80 Mölndal
1 Department of Psychology, Göteborg University, P.O. Box 500, SE-405 30 Göteborg, Sweden

Received 25 January 2000; first review notified 11 April 2000; accepted 28 April 2000


    ABSTRACT
 TOP
 FOOTNOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
Low platelet monoamine oxidase B (MAO-B) activity and the presence of the Taq1 A1 allele of the dopamine D2 receptor (DRD2) gene have independently been proposed as ‘biological/genetic’ markers for alcoholism. In the present study, the relationship between these two markers was investigated in a group of socially stable Caucasian middle-aged men with a mean (±SD) daily ethanol consumption of 85 ± 57 g. The platelet MAO-B activity was significantly lower in individuals with the DRD2 A1 allele (n = 8), compared to those without it (n = 29). This relationship remained unchanged when including only subjects who fulfilled DSM-IV criteria for alcohol dependence (n = 27). The finding suggests that alcoholics who are carriers of the DRD2 A1 allele may have lower platelet MAO-B activity.


    INTRODUCTION
 TOP
 FOOTNOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
There are several major research fields for identifying ‘biological/genetic’ markers in alcoholism. One of these research areas involves studies concerning the prevalence of the A1 allele for the dopamine D2 receptor (DRD2) gene. Blum et al. (1990) found an increase of the DRD2 A1 allele frequency in subjects with alcoholism. Since this initial report, several studies have been published and an increase of the DRD2 A1 allele frequency has been reported particularly in more severe forms of alcoholism (e.g. Parsian et al., 1991; Conneally, 1991; Blum et al., 1991, 1993; Noble et al., 1991, 1994b; Amadeo et al., 1993; Arinami et al., 1993; Kono et al., 1997; Lawford et al., 1997; Ishiguro et al., 1998). However, several other studies have not shown such evidence for linkage or association of the DRD2 A1 allele with alcohol dependence (Bolos et al., 1990Go; Gelernter et al., 1991Go; Turner et al., 1992Go; Geijer et al., 1994Go; Gejman et al., 1994Go; Suarez et al., 1994Go; Cook et al., 1996Go; Finckh et al., 1996Go; Lu et al., 1996Go; Goldman et al., 1997Go, 1998Go; Edenberg et al., 1998Go; Lee et al., 1999Go; Sander et al., 1999Go).

Another major research area involves studies of platelet monoamine oxidase (MAO)-B activity in alcoholism. As a result of several studies, low platelet MAO-B activity has been proposed as a biological marker for alcoholism, especially in the type 2 alcoholism with personality traits such as sensation-seeking behaviour (Wiberg et al., 1977Go; Sullivan et al., 1978Go, 1990Go; von Knorring et al., 1984Go; Faraj et al., 1987Go; Pandey et al., 1988Go; Devor et al., 1993Go; Rommelspacher et al., 1994Go; Hallman et al., 1996Go; von Knorring and Oreland, 1996Go). Also in this research area, there are studies where no such association have been observed (Tabakoff et al., 1988Go; Parsian et al., 1995Go; Anthenelli et al., 1998Go; Farren et al., 1998Go).

Since both platelet MAO-B activity and alleles for the DRD2 receptor reflect in different ways central dopaminergic neurotransmission, a transmitter system considered important for the central nervous system reward (Wise and Rompre, 1989Go) and motivation, it seems reasonable to investigate whether platelet MAO-B activity and the DRD2 A1 allele are associated. The aim of this preliminary study was therefore to investigate platelet MAO-B activity in alcoholics both with and without the DRD2 A1 allele.


    MATERIALS AND METHODS
 TOP
 FOOTNOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
Subjects
Forty subjects were recruited by advertisement in a local daily newspaper. They had to be males, aged 25–65 years, socially stable, and without any physical or psychiatric disorder not associated with alcohol intake. They should furthermore not have had a diagnosis of abuse or dependence on other substances, with the exception of nicotine. Their weekly alcohol consumption should have exceeded 300 g. Thirty-seven Caucasian subjects were found to fulfil these criteria and could thus participate in the study.

Study design
On the investigation day, the subjects were examined physically and psychiatrically by a psychiatrist using a semi-structured interview at an alcoholism treatment unit of the University Hospital. Their social background data were collected and they were assessed for alcohol-dependence according to the Diagnostic and Statistical Manual for Mental Disorders (DSM-IV) criteria of the American Psychiatric Association (1994). The daily alcohol consumption during the last 2 weeks was estimated using the method of TimeLine Follow Back (Sobell et al., 1980Go). Anxiety and depressive symptoms were assessed using the Hamilton Anxiety Scale (HAS; range of scores 0–56; Hamilton, 1960) and the Hamilton Depression Scale (HDS; range of scores 0–52; Hamilton, 1967) respectively. Personality characteristics were assessed using the Karolinska Scales of Personality self-rating instrument (KSP; Schalling, 1993). Blood samples were collected for the determination of platelet MAO-B activity, the A1/A2 allele, as well as liver function tests [aspartate aminotransferase (AST), alanine aminotransferase (ALT) and {gamma}-glutamyltransferase (GGT); upper laboratory reference limit for all liver enzymes: 0.8 µkat/l], renal and haematological functions and carbohydrate deficient transferrin (CDT; upper laboratory reference limit: 1.7%). Determination of narcotic drugs (including benzodiazepines) in urine samples was also performed, using suitable laboratory screening procedures.

Biochemical analyses
Platelets were isolated from EDTA–blood as previously described (Svennerholm et al., 1982Go). The cell homogenate used as enzyme source in the assay of MAO-B was prepared by sonication in ice-chilled water for 60 s. The protein content of the homogenate was determined by the bicinchoninic acid procedure (Smith et al., 1985Go). The enzyme activity was assayed radiochemically with ß-phenylethylamine as substrate with a concentration of 5.0 µM in the final assay (Fowler and Tipton, 1981Go). The specific enzyme activity is expressed as µkat/kg cell protein. The intra-assay variation was 4–6%, calculated on assayed duplicates of different samples. For determination of the inter-assay precision, a pool of platelets was aliquoted and stored at –80°C. Fresh aliquots were assayed on seven different occasions during a 5-month period. The inter-assay variation of the pooled platelet samples was 10%.

The DRD2 TaqA polymerase chain reaction (PCR) was performed as described by Grandy et al. (1993) with minor modifications. In short, genomic DNA was extracted from venous blood samples, and the DRD2 gene was amplified by PCR using the primers 5'CCGTCGACGGCTGGCCAAGTTGTCTA and 5'CCGTCGACCCTTCCTGAGTGTCATCA. The 310 bp PCR product was cleaved with TaqI, resulting in cleavage of the DRD2* 2 allele into two fragments of 180 and 130 bp, whereas the DRD2* 1 allele was not cleaved (Fig. 1Go).



View larger version (76K):
[in this window]
[in a new window]
 
Fig. 1. Representative example of the dopamine D2 receptor (DRD2)TaqA polymerase chain reaction (PCR).

Lane 1: the uncleaved PCR product; lane 2: patient homozygous for the DRD2 1 allele (uncleaved 310 bp PCR product); lane 3: patient homozygous for the DRD2 2 allele (PCR product cleaved into two fragments of 180 and 130 bp); and lane 4: patient heterozygous for the DRD2 1 and DRD2 2 alleles (both uncleaved 310 bp and cleaved 180 and 130 bp PCR products). Molecular weight markers are shown on the left.

 
Statistical analyses
The subjects were grouped according to the presence of the DRD2 A1 allele (A1+) or absence (A1–). Between-group comparisons (background data, alcohol consumption, platelet MAO-B activity, and results of liver function tests) were performed using one-way ANOVA (StatView, Abacus). The data are presented as means ± SD. The study was approved by the Ethics Committee of Göteborg University, Sweden. Informed consent was obtained from all subjects.


    RESULTS
 TOP
 FOOTNOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
Background data
The mean (±SD) age of the subjects was 51 ± 7 years. No signs or symptoms of clinically significant anxiety (HAS: total scores of 6.3 ± 6.8) or depression (HDS: total scores of 3.1 ± 3.5) were found. Scores of the personality variables of the KSP were not found to differ from those of a normal group (data not shown). The subjects reported alcohol drinking problems for 11 ± 10 years, but none with onset before the age of 25 years. Their mean daily alcohol consumption was 85 ± 57 g during the 2 weeks preceding the investigation. Twenty-seven subjects (73%) fulfilled DSM-IV criteria for alcohol dependence. The remaining 10 subjects fulfilled only one or two of these DSM criteria. None of the 37 subjects had any other psychiatric diagnoses according to DSM-IV; 18 subjects (49%) were nicotine users.

Results of liver function tests were for AST 0.60 ± 0.49 µkat/l, ALT 0.89 ± 0.79 µkat/l, GGT 1.47 ± 1.25 µkat/l, and CDT 2.4 ± 2.6%. Platelet MAO-B activity in the total group was 5.2 ± 1.9 µkat/kg protein (laboratory reference value: 5.1 ± 1.3 µkat/kg protein). There were no correlations between age or years of drinking problems vs levels of platelet MAO-B activity (r = 0.04 and 0.19 respectively). In the alcohol-dependent subjects platelet MAO-B activity was 5.1 ± 2.0 and in those subjects who only fulfilled one or two of DSM-IV criteria for alcohol dependence 5.4 ± 1.8 µkat/kg protein. There was also no difference between nicotine users and non-users in platelet MAO-B activity (5.2 ± 1.7 and 5.2 ± 2.1 µkat/kg protein respectively). Among the smokers, no correlation was observed between amount of current smoking (daily numbers of cigarettes) and levels of platelet MAO-B activity (r = 0.19). Renal and haematological function tests were all within their normal ranges.

DRD2 A1 allele (A1+) and (A1–)
In the total group of 37 subjects, eight subjects (22%) were carriers of the DRD2 A1 allele (A1+), of whom one was a homozygote. Consequently, the remaining 29 subjects (78%) were non-carriers of the DRD2 A1 allele (A1–). In the alcohol-dependent subjects (n = 27), six subjects were A1+, whereas 21 were A1–, and in those subjects who only fulfilled one or two of DSM-IV criteria for alcohol dependence (n = 10) two were A1+ and eight A1– (n.s.). Of the eight carriers with A1+, three were nicotine users, and, among the 29 subjects with A1–, 15 were nicotine users.

There were no differences in background data between the A1+ and A1– groups (Table 1Go). Nor were there any differences in scores of the personality variables of the KSP (to be published). Furthermore, no differences were found in liver function between the groups, with the exception of GGT: the A1+ group had higher levels of GGT, compared to the A1– group [F(1,35) = 6.21; P < 0.05; Table 1Go].


View this table:
[in this window]
[in a new window]
 
Table 1. Values for background data and liver function in alcoholics
 
As seen in Fig. 2Go, the A1+ group had a significantly lower platelet MAO-B activity than the A1– group [3.6 ± 1.3 and 5.6 ± 1.8 µkat/kg protein respectively; F(1,34) = 8.65; P < 0.01]. When including only subjects fulfilling DSM-IV criteria for alcohol-dependence (n = 27) in the analyses, the relationship between platelet MAO-B activity and the A1 allele was almost unchanged [A1+: 3.8 ± 1.3 and A1–: 5.5 ± 1.9 µkat/kg protein; F(1,25) = 3.76; P = 0.06].



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2. Individual values for platelet monoamine oxidase B (MAO-B) activity.

Activity is in (µkat/kg protein) in alcoholics with the presence (A1+; n = 8) or absence (A1–; n = 29) of the DRD2 A1 allele. The MAO-B activity was significantly lower in the A1+ group (P < 0.01). The horizontal lines represent mean values for each group.

 

    DISCUSSION
 TOP
 FOOTNOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
In the present study, we investigated the relationship between platelet MAO-B activity and the presence or absence of the DRD2 A1 allele in a group of middle-aged Caucasian men with a mean daily alcohol consumption of 85 g. In spite of their high daily alcohol intake, the subjects were socially stable, employed, and were without signs of personality divergence. The late onset of alcohol problems further strengthens the assumption that they can be characterized as type 1 alcoholics according to the typology of Cloninger et al. (1981).

The percentage of subjects who were carriers of the DRD2 A1 allele was about 20% (22% in the alcohol-dependent subjects and 20% in those subjects who only fulfilled one or two of the DSM-IV criteria for alcohol dependence). In a recent review by Noble (1998), in which a meta-analysis of several studies has been performed, it was reported that 47.7% of more severe alcoholics, 31.6% of less severe alcoholics, and 15.7% of controls (alcoholics and/or drug abusers excluded) are carriers of this allele. The relatively low frequency of the DRD2 A1 allele in the present study is somewhat surprising. One explanation could be that this study includes a fairly low number of subjects. Furthermore, 27% of the subjects were non-dependent according to DSM-IV, i.e. they fulfilled only one or two of the criteria and have therefore been characterized as ‘diagnostic orphans’ according to Hasin and Paykin (1999) and Pollock and Martin (1999). None, however, fulfilled the DSM-IV criteria for alcohol abuse. Finally, few subjects reported any degree of medical complications related to their alcoholism and thus could not be defined as severe according to the concept of severity (medically ill), as suggested for subjects with the presence of the DRD2 A1 allele (see Noble, 1998). It should also be emphasized that the aim of this study was not to investigate the prevalence of the DRD2 A1 allele in alcoholics.

We found that platelet MAO-B activity was significantly lower in subjects having the DRD2 A1 allele, compared to those not having this allele. This relationship remained unchanged when only subjects who fulfilled the DSM-IV criteria for alcohol dependence were considered. Furthermore, as can be seen in Fig. 2Go, subjects with platelet MAO-B activity above 5.6 µkat/kg protein (mean value for platelet MAO-B activity in the A1-group) were all non-carriers of the A1 allele. This finding that alcoholics who are carriers of the DRD2 A1 allele have lower platelet MAO-B activity has to our knowledge not been reported earlier. The contradictory findings about whether alcoholism is associated with low platelet MAO-B activity or not may at least be partly explained by the results of the present study. Thus, if a study population contains an abundance of individuals carrying the DRD2 A1 allele the mean level of platelet MAO-B activity could be expected to be low.

Besides a possible relationship to alcoholism, low platelet MAO-B activity has also been reported in smokers (von Knorring et al., 1984Go; Anthenelli et al., 1995Go). In recent reports, Anthenelli et al. (1998, 1999) suggested that low platelet MAO-B activity is a state marker for cigarette smoking, rather than a trait marker for alcoholism or its subgroups. In the present study, there was no evidence for a difference in platelet MAO-B activity between nicotine users and non-users, although the number of subjects might have been too small to detect a difference. However, our results are in line with a study by Farren et al. (1998), who used a larger number of subjects (46 abstinent alcoholics and 22 controls) and found no correlation between platelet MAO-B activity and smoking status. Thus, in our opinion, the relationship between platelet MAO-B activity and smoking status in alcoholics needs to be further clarified. Furthermore, it should be noted that, according to Noble et al. (1994a), the prevalence of the A1 allele is higher in active as well as ex-smokers, compared to non-smokers.

MAO-B is important for the degradation of dopamine in the brain. Whether the platelet MAO-B activity reflects central MAO-B activity in the brain has been discussed. In a previous study, using positron emission tomography, brain and platelet MAO-B activity were shown to be highly correlated (Bench et al., 1991Go). Furthermore, the expression of the A1 polymorphism of the DRD2 receptor gene is not fully understood. There is, however, evidence for a reduced DRD2 receptor density in the striatal region in the brain in A1+ subjects (Pohjalainen et al., 1996Go; Noble, 1998Go), suggesting a down-regulated receptor function in this region. Subjects with the DRD2 A1 allele may therefore hypothetically maintain their homeostasis in dopaminergic neurotransmission through a compensatory decrease in the central MAO-B activity. It is noteworthy in this context that alcohol-dependent subjects with neuroendocrine evidence for reduced postsynaptic DRD2 receptor function have decreased platelet MAO-B activity (Berggren et al., 2000Go), as opposed to findings reported in studies by Balldin et al. (1994) and Farren and Dinan (1996).

To our knowledge, this is the first report of lower platelet MAO-B activity in alcoholics carrying the DRD2 A1 allele polymorphism. The number of subjects in the present study is, however, relatively small and it is therefore important to further investigate if this association could be replicated, not only in alcoholism but also in individuals with other psychiatric disorders and in healthy subjects. If replicated, our finding suggests that future studies on platelet MAO-B activity in different groups of alcoholism should include determination of the DRD2 A1 allele frequency.


    ACKNOWLEDGEMENTS
 TOP
 FOOTNOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
This study was supported by grants from the Swedish Alcohol Monopoly Foundation for Alcohol Research and the Swedish Medical Research Council (K-98-21P-11842-03A).


    FOOTNOTES
 TOP
 FOOTNOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
* Author to whom correspondence should be addressed. Back


    REFERENCES
 TOP
 FOOTNOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
Amadeo, S., Abbar, M., Fourcade, M. L., Waksman, G., Leroux, M. G., Madec, A., Selin, M., Champiat, J. C., Brethome, A. and Leclaire, Y. (1993) D2 dopamine receptor gene and alcoholism. Journal of Psychiatric Research 27, 173–179.[Web of Science][Medline]

American Psychiatric Association (1994) Diagnostic and Statistical Manual of Mental Disorders, 4th edn. American Psychiatric Association Press, Washington, DC.

Anthenelli, R. M., Smith, T. L., Craig, C. E., Tabakoff, B. and Schuckit, M. A. (1995) Platelet monoamine oxidase activity levels in subgroups of alcoholics: Diagnostic, temporal, and clinical correlates. Biological Psychiatry 138, 361–368.

Anthenelli, R. M., Tipp, J., Li, T.-K., Magnes, L., Schuckit, M. A., Rice, J., Daw, W. and Nurnberger, J. I. (1998) Platelet monoamine oxidase activity in subgroups of alcoholics and controls: Results from the collaborative study on the genetics of alcoholism. Alcoholism: Clinical and Experimental Research 22, 598–604.[Web of Science][Medline]

Anthenelli, R. M., Maxwell, R. A., Ovchinikova, L. and Tabakoff, B. (1999) Are some trait markers of alcoholism really state markers of cigarette smoking? Alcoholism: Clinical and Experimental Research 23 (Suppl.), 59A.

Arinami, T., Itokawa, M., Komiyama, T., Mitsushio, H., Mori, H., Mifune, H., Hamaguchi, H. and Toru, M. (1993) Association between severity of alcoholism and the A1 allele of the dopamine D2 receptor gene TaqI-A RFLP in Japanese. Biological Psychiatry 33, 108–114.[Web of Science][Medline]

Balldin, J., Berggren, U, Lindstedt, G. and Oreland L. (1994) Alcoholics with reduced dopamine D2 receptor function possess normal platelet monoamine oxidase activity. Alcohol and Alcoholism 29, 659–661.[Abstract/Free Full Text]

Bench, C. J., Price, G. W., Lammertsmaa, A. A., Cremer, J. C., Luthra, S. K., Turton, D., Dolan, R. J., Kettler, R., Dingemanse, J., Da Prada, M., Biziere, K., McClelland, G. R., Jamieson, V. L., Wood, N. D. and Frackowiak, R. S. J. (1991) Measurement of human cerebral monoamine oxidase type B (MAO-B) activity with positron emission tomography (PET): a dose ranging study with the reversible inhibitor Ro 19-6327. European Journal of Clinical Pharmacology 40, 169–173.[Web of Science][Medline]

Berggren, U., Fahlke, C. and Balldin, J. (2000) Alcohol-dependent patients with neuroendocrine evidence for reduced dopamine D2 receptor function have decreased platelet monoamine oxidase-B activity. Alcohol and Alcoholism 35, 210–211.[Free Full Text]

Blum, K., Noble, E. P., Sheridan, P. J., Montgomery, A., Ritchie, T., Jagadeeswaran, P., Nogami, H., Briggs, A. H. and Cohn, J. B. (1990) Allelic association of human dopamine D2 receptor gene in alcoholism. Journal of the American Medical Association 263, 2055–2060.[Abstract/Free Full Text]

Blum, K., Noble, E. P., Sheridan, P. J., Finley, O., Montgomery, A., Ritchie, T., Ozkaragoz, T., Fitch, R. J., Sadlack, F., Sheffield, D., Dahlmann, T., Halbardier, S. and Nogami, H. (1991) Association of the A1 allele of the D2 dopamine receptor gene with severe alcoholism. Alcohol 8, 409–416.[Web of Science][Medline]

Blum, K., Noble, E. P., Sheridan, P. J., Montgomery, A., Ritchie, T., Ozkaragoz, T., Fitch, R. J., Wood, R., Finley, O. and Sadlack, F. (1993) Genetic predisposition in alcoholism: association of the D2 dopamine receptor TaqI B1 RFLP with severe alcoholics. Alcohol 10, 59–67.[Web of Science][Medline]

Bolos, A. M., Dean, M., Lucas-Derse, S., Ramsburg, M., Brown, G. L. and Goldman, D. (1990) Population and pedigree studies reveal a lack of association between the dopamine D2 receptor gene and alcoholism. Journal of the American Medical Association 264, 3156–3160.[Abstract/Free Full Text]

Cloninger, C. R., Bohamn, M., Sigvardsson, S. (1981) Inheritance of alcohol abuse. Archives of General Psychiatry 38, 861–868.[Abstract/Free Full Text]

Conneally, P. M. (1991) Association between the D2 dopamine receptor gene and alcoholism. A continuing controversy. Archives of General Psychiatry 48, 664–666.[Abstract/Free Full Text]

Cook, C. C., Palsson, G., Turner, A., Holmes, D., Brett, P., Curtis, D., Petursson, H. and Gurling, H. M (1996) A genetic linkage study of the D2 dopamine receptor locus in heavy drinking and alcoholism. British Journal of Psychiatry 169, 243–248.[Abstract/Free Full Text]

Devor, E. J., Cloninger, C. R., Hoffman, P. L. and Tabakoff, B. (1993) Association of monoamine oxidase (MAO) activity with alcoholism and alcoholic subtypes. American Journal of Medical Genetics 48, 209–213.[Web of Science][Medline]

Edenberg, H. J., Foroud, T., Koller, D. L., Begleiter, H., Bucholz, K. K., Conneally, P. M., Crowe, R., Goate, A., Hesselbrock, V., Li, T. K., Nurnberger, J. I. Jr, Porjesz, B., Reich, T., Rice, J. P., Schuckit, M., Tischfield, J. A. and Foroud, T. (1998) A family-based analysis of the association of the dopamine D2 receptor (DRD2) with alcoholism. Alcoholism: Clinical and Experimental Research 22, 505–512.[Web of Science][Medline]

Faraj, B. A., Lenton, J. D., Kutner, M., Camp, V. M., Stammers, T. W., Lee, S. R., Lolies, P. A. and Chandora, D. (1987) Prevalence of low monoamine oxidase function in alcoholism. Alcoholism: Clinical and Experimental Research 11, 464–467.[Web of Science][Medline]

Farren C. K. and Dinan, T. G. (1996) Platelet monoamine oxidase-B activity in alcoholics with lowered dopamine D2 receptor activity. Alcohol and Alcoholism 31, 307–308.[Free Full Text]

Farren, C. K., Clare, A. W., Tipton, K. F. and Dinan, T. G. (1998) Platelet MAO activity in subtypes of alcoholics and controls in a homogeneous population. Journal of Psychiatric Research 32, 49–54.[Web of Science][Medline]

Finckh, U., von Widdern, O., Giraldo-Velasquez, M., Podschus, J., Dufeu, P., Sander, T., Harms, H., Schmidt, L. G., Rommelspacher, H. and Rolfs, A. (1996) No association of the structural dopamine D2 receptor (DRD2) variant 311Cys with alcoholism. Alcoholism: Clinical and Experimental Research 20, 528–532.[Web of Science][Medline]

Fowler, C. J. and Tipton, K. F. (1981) Concentration dependence of the oxidation of tyramine by the two forms of rat liver mitochondrial monoamine oxidase. Biochemical Pharmacology 31, 3329–3332.[Web of Science]

Geijer, T., Neiman, J., Rydberg, U., Gyllander, A., Jönsson, E., Sedvall, G., Valverius, P. and Terenius, L. (1994) Dopamine D2-receptor gene polymorphisms in Scandinavian chronic alcoholics. European Archives of Psychiatry and Clinical Neuroscience 244, 26–32.[Web of Science][Medline]

Gejman, P. V., Ram, A., Gelernter, J., Friedman, E., Cao, Q., Pickar, D., Blum, K., Noble, E. P., Kranzler, H. R., O'Malley, S., Hamer, D. H., Whitsitt, F., Rao, P., DeLisi, L. E., Virkkunen, M., Linnoila, M., Goldman, D. and Gershon, E. S. (1994) No structural mutation in the dopamine D2 receptor gene in alcoholism or schizophrenia. Analysis using denaturing gradient gel electrophoresis. Journal of the American Medical Association 271, 204–208.[Abstract/Free Full Text]

Gelernter, J., O'Malley, S., Risch, N., Kranzler, H. R., Krystal, J., Merikangas, K., Kennedy, J. L. and Kidd, K. K. (1991) No association between an allele at the D2 dopamine receptor gene (DRD2) and alcoholism. Journal of the American Medical Association 266, 1801–1807.[Abstract/Free Full Text]

Goldman, D., Urbanek, M., Guenther, D., Robin, R. and Long, J. C. (1997) Linkage and association of a functional DRD2 variant [Ser311Cys] and DRD2 markers to alcoholism, substance abuse and schizophrenia in Southwestern American Indians. American Journal of Medical Genetics 74, 386–394.[Web of Science][Medline]

Goldman, D., Urbanek, M., Guenther, D., Robin, R. and Long, J. C. (1998) A functionally deficient DRD2 variant [Ser311Cys] is not linked to alcoholism and substance abuse. Alcohol 16, 47–52.[Web of Science][Medline]

Grandy, D. K., Zhang, Y. and Civelli, O. (1993) PCR detection of the TaqA RFLP at the DRD2 locus. Human Molecular Genetics 2, 2197.[Free Full Text]

Hallman, J., von Knorring, L. and Oreland L (1996) Personality disorders according to DSM-III-R and thrombocyte monoamine oxidase activity in type 1 and type 2 alcoholics. Journal of Studies on Alcohol 57, 155–161.[Web of Science][Medline]

Hamilton, M. (1960) The assessment of anxiety states by rating. British Journal of Psychology 32, 50–55.[Web of Science]

Hamilton, M. (1967) Development of a rating scale for primary depressive illness. British Journal of Sociology and Clinical Psychology 6, 278–296.

Hasin, D. and Paykin, A. (1999) Dependence symptoms but no diagnosis: diagnostic ‘orphans’ in a 1992 national sample. Drug and Alcohol Dependence 53, 215–222.[Web of Science][Medline]

Ishiguro, H., Arinami, T., Saito, T., Akazawa, S., Enomoto, M., Mitushio, H., Fujishiro, H., Tada, K., Akimoto, Y., Mifune, H., Shioduka, S., Hamaguchi, H., Toru, M. and Shibuya, H. (1998) Association study between the –141C Ins/Del and TaqI A polymorphisms of the dopamine D2 receptor gene and alcoholism. Alcoholism: Clinical and Experimental Research 22, 845–848.[Web of Science][Medline]

Kono, Y., Yoneda, H., Sakai, T., Nonomura, Y., Inayama, Y., Koh, J., Sakai, J., Inada, Y., Imamichi, H. and Asaba, H. (1997) Association between early-onset alcoholism and the dopamine D2 receptor gene. American Journal of Medical Genetics 74, 179–182.[Web of Science][Medline]

Lawford, B. R., Young, R. M., Rowell, J. A., Gibson, J. N., Feeney, G. F., Ritchie, T. L., Syndulko, K. and Noble, E. P. (1997) Association of the D2 dopamine receptor A1 allele with alcoholism: medical severity of alcoholism and type of controls. Biological Psychiatry 41, 386–393.[Web of Science][Medline]

Lee, J. -F., Lu, R.-B., Ko, H.-C., Chang, F.-M., Yin, S.-J., Pakstis, A. J. and Kidd, K. K. (1999) No association between DRD2 locus and alcoholism after controlling the ADH and ALDH genotypes in Chinese Han population. Alcoholism: Clinical and Experimental Research 23, 592–599.[Web of Science][Medline]

Lu, R. B., Ko, H. C., Chang, F. M., Castiglione, C. M., Schoolfield, G., Pakstis, A. J., Kidd, J. R. and Kidd, K. K. (1996) No association between alcoholism and multiple polymorphisms at the dopamine D2 receptor gene (DRD2) in three distinct Taiwanese populations. Biological Psychiatry 39, 419–429.[Web of Science][Medline]

Noble, E. P. (1998) The D2 dopamine receptor gene: a review of association studies in alcoholism and phenotypes. Alcohol 16, 33–45.[Web of Science][Medline]

Noble, E. P., Blum, K., Ritchie, T., Montgomery, A. and Sheridan, P. J. (1991) Allelic association of the D2 dopamine receptor gene with receptor-binding characteristics in alcoholism. Archives of General Psychiatry 48, 648–654.[Abstract/Free Full Text]

Noble, E. P., St. Jeor, S. T., Ritchie, T., Syndulko, K., St. Jeor, S. C., Fitch, R. J., Brunner, R. L. and Sparkes, R. S. (1994a) D2 dopamine receptor gene and cigarette smoking: a reward gene? Medical Hypotheses 42, 257–260.[Web of Science][Medline]

Noble, E. P., Syndulko, K., Fitch, R. J., Ritchie, T., Bohlman, M. C., Guth, P., Sheridan, P. J., Montgomery, A., Heinzmann, C., Sparkes, R. S. and Blum, K. (1994b) D2 dopamine receptor TaqI A alleles in medically ill alcoholic and nonalcoholic patients. Alcohol and Alcoholism 29, 729–744.[Abstract/Free Full Text]

Pandey, G. N., Fawcett, J., Gibbons, R., Clark, D. C. and Davis, J. M. (1988) Platelet monoamine oxidase in alcoholism. Biological Psychiatry 24, 15–24.[Web of Science][Medline]

Parsian, A., Todd, R. D., Devor, E. J., O'Malley, K. L., Suarez, B. K., Reich, T. and Cloninger, C. R. (1991) Alcoholism and alleles of the human D2 dopamine receptor locus. Studies of association and linkage. Archives of General Psychiatry 48, 655–663.[Abstract/Free Full Text]

Parsian, A., Suarez, B. K., Tabakoff, B., Hoffman, P., Ovchinnikova, L., Fisher, L. and Cloninger, C. R. (1995) Monoamine oxidases and alcoholism. I. Studies in unrelated alcoholics and normal controls. American Journal of Medical Genetics 60, 405–416.

Pohjalainen, T., Rinne, J., Nägren, K., Lehikoinen, P., Antilla, K., Syvälahti, E. and Hietala, J. (1996) Genetic determinant of human D2 dopamine receptor binding characteristics in vivo. American Journal of Human Genetics 59, A387.

Pollock, N. K. and Martin, C. S. (1999) Diagnostic orphans: adolescents with alcohol symptoms who do not qualify for DSM-IV abuse or dependence diagnoses. American Journal of Psychiatry 156, 897–901.[Abstract/Free Full Text]

Rommelspacher, H., May, T., Dufeu, P. and Schmidt, L. G. (1994) Longitudinal observations of monoamine oxidase B in alcoholics: differentiation of marker characteristics. Alcoholism: Clinical and Experimental Research 18, 1322–1329.[Web of Science][Medline]

Sander, T., Ladehoff, M., Samochowiec, J., Finckh, U., Rommelspacher, H. and Schmidt, L. G. (1999) Lack of an allelic association between polymorphisms of the dopamine D2 receptor gene and alcohol dependence in the German population. Alcoholism: Clinical and Experimental Research 23, 578–581.[Web of Science][Medline]

Schalling, D. (1993) Neurochemical correlates of personality, impulsivity, and disinhibitory suicidality. In Mental Disorder and Crime, Hodgkins, S. ed., pp. 208–226. New York.

Smith, P. K., Krohn, R. I., Hermansson, G. T., Mallia, A. K., Gartner, F. H., Provenzano, M. D., Fujimoto, E. K., Goeke, N. M. and Klenk, D. C. (1985) Measurement of protein using bicinchoninic acid. Analytical Biochemistry 159, 76–85.

Sobell, M. B., Maistro, S. A., Sobell, L. C., Cooper, A. M., Cooper, T. C. and Sanders, B. (1980) Developing a prototype for evalu-ating alcohol treatment effectiveness. In Evaluating Alcohol and Drug Abuse Treatment Effectiveness: Recent Advances, Sobell, L. C., Sobell, M. B. and Ward, E. eds. Pergamon Press, New York.

Suarez, B. K., Parsian, A., Hampe, C. L., Todd, R. D., Reich, T. and Cloninger, C. R. (1994) Linkage disequilibria at the D2 dopamine receptor locus (DRD2) in alcoholics and controls. Genomics 19, 12–20.[Web of Science][Medline]

Sullivan, J. L., Stanfield, C. N., Schanberg, S. and Cavenar, J. (1978) Platelet monoamine oxidase and serum dopamine-beta-hydroxylase activity in chronic alcoholics. Archives of General Psychiatry 35, 1209–1212.[Abstract/Free Full Text]

Sullivan, J. L., Baenziger, J. C., Wagner, D. L., Rauscher, F. P., Nurnberger, J. I. Jr and Holmes, J. S. (1990) Platelet MAO in subtypes of alcoholism. Biological Psychiatry 27, 911–922.[Web of Science][Medline]

Svennerholm, L., Håkansson, G., Månsson, J.-E. and Nilsson, O. (1982) Chemical differentiation of the Gaucher subtypes. In Gauchers' Disease: A Century of Delineation and Research, Desnick, R. J., Gatt, S. and Grabowsky, G. A. eds, pp. 231–252. Alan R. Liss, New York.

Tabakoff, B., Hoffman, P. L., Lee, J. M., Saito, T., Willard, B. and De Leon-Jones, F. (1988) Differences in platelet enzyme activity between alcoholics and nonalcoholics. New England Journal of Medicine 318, 134–139.[Abstract]

Turner, E., Ewing, J., Shilling, P., Smith, T. L., Irwin, M., Schuckit, M. and Kelsoe, J. R. (1992) Lack of association between an RFLP near the D2 dopamine receptor gene and severe alcoholism. Biological Psychiatry 31, 285–290.[Web of Science][Medline]

von Knorring, L. and Oreland, L. (1996) Platelet MAO activity in type 1/type 2 alcoholics. Alcoholism: Clinical and Experimental Research 20 (Suppl.), 224A–230A.[Medline]

von Knorring, L., Oreland, L. and Winblad, B. (1984) Personality traits related to monoamine oxidase activity in platelets. Psychiatry Research 12, 11–26.[Web of Science][Medline]

Wiberg, A., Gottfries, C. G. and Oreland, L. (1977) Low platelet monoamine oxidase activity in human alcoholics. Medical Biology 55, 181–186.[Web of Science][Medline]

Wise, R. A. and Rompre, P.-P. (1989) Brain dopamine and reward. Annual Review of Psychology 40, 191–225.[Web of Science][Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Alcohol AlcoholHome page
S. Pombo, P. Levy, M. Bicho, F. Ismail, and J M N. Cardoso
Neuropsychological Function and Platelet Monoamine Oxidase Activity Levels in Type I Alcoholic Patients
Alcohol Alcohol., July 1, 2008; 43(4): 423 - 430.
[Abstract] [Full Text] [PDF]


Home page
Alcohol AlcoholHome page
U. BERGGREN, C. FAHLKE, E. ARONSSON, A. KARANTI, M. ERIKSSON, K. BLENNOW, D. THELLE, H. ZETTERBERG, and J. BALLDIN
THE TAQI DRD2 A1 ALLELE IS ASSOCIATED WITH ALCOHOL-DEPENDENCE ALTHOUGH ITS EFFECT SIZE IS SMALL
Alcohol Alcohol., September 1, 2006; 41(5): 479 - 485.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (9)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Eriksson, M.
Right arrow Articles by Balldin, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Eriksson, M.
Right arrow Articles by Balldin, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?