Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Oretti, R. G.
Right arrow Articles by Buckland, P. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oretti, R. G.
Right arrow Articles by Buckland, P. R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Alcohol and Alcoholism Vol. 35, No. 5, pp. 427-434, 2000
© 2000 Medical Council on Alcoholism

RAT LIVER TRYPTOPHAN PYRROLASE ACTIVITY AND GENE EXPRESSION DURING ALCOHOL WITHDRAWAL

R. G. Oretti2, S. Bano3, M. O. Azani, A. A.-B. Badawy1,*, C. J. Morgan1, P. McGUFFIN4 and P. R. Buckland

Department of Psychological Medicine, University of Wales College of Medicine, Heath Park, Cardiff CF14 4XN
1 Cardiff and Vale NHS Trust, Biomedical Research Laboratory, Whitchurch Hospital, Cardiff CF14 7XB, UK

Received 7 March 2000; first review notified 2 May 2000; accepted 4 May 2000


    ABSTRACT
 TOP
 FOOTNOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
Rat liver tryptophan (Trp) pyrrolase activity and gene expression were studied in relation to the alcohol-withdrawal syndrome (AWS). Both activity and gene expression were enhanced after withdrawal of ethanol-containing liquid diets and the time-course of these changes mirrored that of development and intensity of the behavioural disturbances of the AWS. By contrast, no correlation was observed between the AWS-induced behaviour and changes in activity of another hepatic glucocorticoid-inducible enzyme, tyrosine aminotransferase, and a negative correlation was noted between behaviour and the gene expression of this latter enzyme and also of that of the hepatic glucocorticoid receptor. We suggest that the metabolic consequences of activation of liver Trp pyrrolase during alcohol withdrawal may play a role in the behavioural features of the AWS.


    INTRODUCTION
 TOP
 FOOTNOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
The alcohol-withdrawal syndrome (AWS) is believed to reflect a state of neuronal hyperexcitability resulting from a variety of cellular adaptive responses to long-term alcohol consumption. Repeated and inadequately-treated withdrawals can produce future withdrawals of increased severity, analogous to the phenomenon of kindling (Ballenger and Post, 1978Go), and may also be a factor contributing towards alcohol-related brain damage (Lovinger, 1995Go). Although alcohol-withdrawing subjects are now treated with pharmacotherapy to prevent fits and other symptoms (Shaw, 1995Go), a better understanding of the neural mechanisms underlying the AWS may aid in the development of more specific pharmacotherapies, which may attenuate the development of kindling and brain injury.

It is now generally thought that the hyperexcitability of the AWS in animals may involve activation of the excitatory N-methyl-d-aspartate (NMDA)-type of glutamate receptors in response to withdrawal of ethanol following its long-term heavy consumption (for reviews, see Gonzales, 1990; Lovinger, 1995). Physiologically occurring substances which modulate NMDA receptor function include the major excitatory amino acid glutamate, the other excitatory amino acid aspartate, and glycine, and a number of metabolites of the kynurenine pathway of tryptophan (Trp) degradation, namely the excitotoxin quinolinic acid and the convulsant kynurenine, which activate these receptors, and the cytoprotective kynurenic acid, which has antagonistic properties (for a review, see Stone, 1993). As far as we could ascertain, no studies have been performed to examine the possible involvement of the above neuroactive Trp metabolites in the AWS in experimental animals, although their possible involvement has already been postulated (Morgan, 1991Go).

The major source of the above Trp metabolites is the hepatic kynurenine-nicotinic acid pathway, which is controlled by the first and rate-limiting enzyme Trp pyrrolase (Trp 2,3-dioxygenase, EC 1.13.11.11) (for a review of the functions and regulation of this enzyme, see Badawy, 1977). We have previously demonstrated that liver Trp pyrrolase activity is enhanced during alcohol withdrawal by a corticosterone-mediated hormonal induction mechanism (Badawy and Evans, 1973Go, 1975aGo; Badawy et al., 1980bGo) and that a dramatic activation of this enzyme accompanies the appearance of the AWS (Bano et al., 1996Go) in rats. Glucocorticoids are known to enhance the transcription of the Trp pyrrolase gene (DeLap and Feigelson, 1978Go; Nakamura et al., 1987Go) and we found that expression of the pyrrolase mRNA was also dramatically enhanced at 7 h after withdrawal from alcohol (Bano et al., 1996Go). We also found in another study (Oretti et al., 1996Go) that administration of the translational inhibitor cycloheximide to rats during AW prevented the activation of hepatic Trp pyrrolase and the audiogenic seizures characteristic of the AWS.

These findings suggest that Trp pyrrolase activation may be important in the development of the AWS. To study this possibility further, we have performed in the present work a more detailed investigation over a longer time-course of changes in liver Trp pyrrolase activity and mRNA expression in relation to the behavioural changes of the AWS in rats withdrawn from alcohol for various times up to 20 h. Serum corticosterone concentration and hepatic glucocorticoid receptor mRNA expression were also examined, as both parameters are important determinants of Trp pyrrolase synthesis at the transcriptional level. The main purpose of this preliminary study was to find out if changes in the above biochemical parameters could be correlated with, or considered responsible for, the behavioural features of the AWS. Although we observed in our earlier study (Oretti et al., 1996Go) an elevation of liver and brain quinolinate at 7 h after alcohol withdrawal, this and other neuroactive Trp metabolites were not examined in the present work, because it was thought appropriate to ascertain first the time-course of changes in liver Trp pyrrolase, whose activity controls both the rate of Trp degradation and the synthesis of these metabolites. The activity and mRNA expression of another hepatic glucocorticoid-inducible enzyme, tyrosine-2-oxoglutarate aminotransferase (EC 2.6.1.5) were also examined in relation to the actions of glucocorticoids in the context of the present investigation.


    MATERIALS AND METHODS
 TOP
 FOOTNOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
Animals and treatments
Seventy-five locally-bred male Wistar rats, weighing 120–190 g at the start of experiments, were used. Rats were housed in groups of five each in wire-bottomed cages (to prevent coprophagy) under standard conditions (a 12 h light/12 h dark cycle, a constant temperature of 21 ± 1°C and a relative humidity of 55 ± 5%). Seventy of these rats were introduced to liquid diets by making the control diet (Dyets Inc., 2508 Easton Avenue, Bethlem, Pennsylvania, PA 18017, USA) available to them ad libitum as the sole source of calories for 3 days. Ethanol was then introduced into the liquid diet at a concentration of 5% (v/v) for 3 days, then 8% (v/v) for the remaining 18 days. Thirteen groups of five rats each received the alcohol-containing liquid diet for this 3-week duration before withdrawal (see below). One group of five rats continued to receive the control liquid diet for the 3-week ethanol-treatment period. This group acted as a control group which was isocalorically-matched (using maltose-dextrin instead of ethanol) to the ethanol-treated group which was scheduled to be withdrawn for 7 h (see below). A further control group from the original 75 rats remained on the standard Purina chow for a similar 3-week duration. Details of the preparation, composition and nutritional adequacy of the liquid diet have been presented by Lieber et al. (1989). Fresh ethanol-containing (as well as control) liquid diets were replaced daily between 16:00 and 17:00 and all rats had free access to drinking water. Other experimental details of the liquid diet procedure used by us have already been given (Bano et al., 1996Go).

On the day of withdrawal, the alcohol-containing liquid diet was removed at various times, such that each group of rats (i.e. those withdrawn for 0, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 16 and 20 h) could be killed during the period 12:00–15:00. The choice of this time range was to minimize the effect of diurnal variations on liver Trp pyrrolase activity and serum corticosterone concentration. The high frequency of the time-intervals of study during AW was to examine more closely the sequence of events of the various biochemical changes as related to those in behaviour and thus facilitate their correlations. Upon withdrawal, all group cages were moved from their housing environment and placed in a quiet observation room, where they remained undisturbed until assessment. Water was freely available for all the animals in the present work, whereas food was removed for the duration of the withdrawal period, to control for variations in food intake and their possible effects on biochemical and behavioural parameters (see Bano et al., 1996). Unlike consumption of solid chow, which is largely nocturnal, both rats (Bano et al., 1996Go and the present work) and mice (Freund, 1970Go) consume liquid diets both during the light hours and more so at night, such that intake occurs almost throughout the entire day cycle.

Assessment of the behavioural signs of alcohol withdrawal
This was performed as described by Hunter et al. (1975). On the basis of five rats per group, preconvulsive and convulsive behaviours were rated to maximal scores of 25 and 45 respectively (i.e. five and nine scores per rat). The four parameters constituting preconvulsive behaviour (piloerection, startle, tail rigidity and abnormal behaviour) were scored on the basis of absence (0) or presence (1), except startle, which had an extra score point for frantic running. Abnormal behaviour was assessed for absence or presence of normal activities, such as grooming, sleep and exploratory patterns. Susceptibility to audiogenic seizures was then assessed and convulsive behaviour and its pattern were examined according to Hunter et al. (1975). These latter authors and also Watson and Little (1995) and Macey et al. (1996) showed that different behaviours follow different time-courses and, additionally, not all rats show all withdrawal-related behaviours, so that variations from averages are generally wide and the expected total score of 70 for a group of five rats based on the above scoring system is never achieved. Consequently, in the Results section, the behaviour of rats in each group representing a particular time-interval after withdrawal is given as a composite (global) score.

Following these behavioural assessments, the animals were destroyed by CO2 inhalation and decapitation. Livers were perfused in situ with ice-cold 0.9% (w/v) NaCl (saline) and were rapidly removed and frozen in liquid N2. Samples were stored at –70°C until analysis. Blood was also collected at the time of death.

Preparation and quantification of mRNA
Total RNA was extracted using a commercial RNA extraction kit (Ultraspec; Biotecx Labs Inc., Houston, TX, USA) based on the phenol-chloroform extraction method. Total RNA from each liver was analysed using multiprobe oligonucleotide solution hybridization as described previously (Bano et al., 1996Go). Briefly, total RNA (20 µg) and [32P]5'-end-labelled oligonucleotide probes were hybridized in solution. Following the removal of non-bound single-stranded probe using S1 nuclease digestion, the hybridized (and therefore protected) probe was analysed by polyacrylamide gel electrophoresis and autoradiography of the dried gel (exposure for 4 days), followed by scanning densitometry (Ultrascan densitometer, LKB).

Five oligonucleotide probes were used. The rat tryptophan pyrrolase probe consisted of the following 33 bases: 5'-CTAGCAGCCGGAACTGAAGACTCTGGAAGCCTG (Haber et al., 1993Go), whereas the rat tyrosine aminotransferase probe consisted of the following 30 bases: 5' CCAAGTCCAGGCAAAGCAGCCTCCCAGCAG (Rettenmeier et al., 1990Go). The rat glucocorticoid receptor probe consisted of the following 42 bases: 5'-GCTGCTTGGAATCTGCCTGAGAAGCAGCAGCCACTGAGGGCG (Miesfeld et al., 1986Go). The rat ß-actin probe consisted of the following 37 bases: 5'-CTGGTGGCGGGTGTGGACCGGGACGGAGGAGCTGCAA (Nudel et al., 1983Go) and the rat 28S ribosomal RNA probe had 37 bases, as follows: 5'-AATTCAGCGGGTCGCCACGTCTGATCTGAGGTCGCGG (Hadjiolov et al., 1984Go).

The specific activities of the probes were adjusted empirically to ensure that all bands produced by autoradiography were in the linear range of the film (Amersham Hyperfilm MP). Both ß-actin, which is a structural protein, and ribosomal 28S RNA are commonly used as internal controls in gene expression studies. However, in our experiments, we found that the mRNA levels of the 28S RNA were more stable than those of ß-actin, which changed in liver following alcohol administration (by up to 30% of base levels) and could not therefore be used as internal standard. ß-Actin mRNA levels were, however, ascertained (relative to 28S) as a measure of general up-regulation of mRNA levels. By contrast, we found that the 28S ribosomal mRNA probe was stable over the entire experimental observation period and was thus a more reliable marker, in confirmation of previous studies (Leeuw et al., 1989Go). For this reason, 28S mRNA levels were used as an internal standard for RNA quantification. The intensities of the Trp pyrrolase, tyrosine aminotransferase and glucocorticoid receptor bands were therefore adjusted to the corresponding 28S ribosomal mRNA values and expressed as ratios.

Chemical, enzymic and other determinations
Blood-ethanol concentrations were determined enzymatically by a modification of the alcohol dehydrogenase-based kit procedure (Sigma Chemical Company, 1982Go), as described previously (Badawy and Aliyu, 1984Go). The limit of detection by this procedure is 1 mg/dl and the coefficient of variation was found in separate experiments to be 1.85% for triplicate samples and 1.49% for 40 samples. Serum corticosterone concentration was determined fluorimetrically by the highly sensitive (0.5 ng) method of Glick et al. (1964). Liver tryptophan pyrrolase activity was determined in homogenates in either the absence (holoenzyme activity) or the presence (total enzyme activity) of added (2 µM) haematin [Badawy and Evans (1975b); see also the fuller description by Badawy (1981) and additional comments by Badawy et al. (1983)]. Tyrosine aminotransferase activity was also determined in liver homogenates either in the absence (holoenzyme activity) or the presence (total enzyme activity) of added (40 µM) pyridoxal 5'-phosphate as described previously (Badawy et al., 1980aGo). Statistical analysis of results was by using Student' t-test. In assessing the effects of alcohol withdrawal, the choice of the control group for comparative purposes was based on whether the parameter under investigation was not, or was, affected by chronic ethanol administration in the liquid diet or by the control liquid diet itself, such that comparisons of withdrawn groups were made with the unwithdrawn group, the matched liquid diet control group or the solid chow control group respectively, as indicated with the relevant results.


    RESULTS
 TOP
 FOOTNOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
Animal behaviour during acute alcohol withdrawal
Although withdrawal signs began to appear whilst substantial levels of alcohol remained in the blood (i.e. at 2–3 h after withdrawal, see below), the severest of these signs were observed after total ethanol clearance (i.e. after 6 h). Thus, at 2 h and 3 h after alcohol withdrawal, animals began to show signs of piloerection and displayed exaggerated startle responses. From 4 h onwards, piloerection was much more marked, startle responses remained exaggerated and a definite reduction in normal exploratory behaviour was observed. Audiogenic seizures were noted as early as 4 h after alcohol withdrawal, but were no longer elicited at 20 h. The sums of the preconvulsive and convulsive behaviour scores for the different groups of rats are shown as global scores in Fig. 1Go, from which it is clear that 10 h is the time-interval after alcohol withdrawal at which maximum changes in behaviour occurred under our experimental conditions.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 1. Time-course of rat behaviour during the alcohol-withdrawal syndrome.

Ethanol-containing liquid diets were withdrawn for various time-intervals up to 20 h from groups of rats previously maintained on these diets for 3 weeks, as described in the Materials and methods section. Both preconvulsive and convulsive behaviours were assessed; their total scores for each group of five rats are shown here combined as a global score.

 
Blood-ethanol concentrations
Pharmacologically relevant blood-ethanol concentrations were observed in rats chronically treated with ethanol-containing liquid diets. Thus, blood-ethanol concentration (in mg/dl, mean ± SEM for five rats) in the non-withdrawn (0 h) group (killed between 14:00 and 14:20) was 273 ± 43. Blood-ethanol concentration declined rapidly following withdrawal of the ethanol-containing liquid diets. Thus, the mean values (expressed as above for five rats per group) were as follows: 99 ± 36 at 2 h, 63 ± 22 at 3 h and 67 ± 39 at 4 h after withdrawal. By 6 h, ethanol was present in negligible amounts in blood (4 ± 2 mg/dl) and was no longer detectable at subsequent time-intervals of withdrawal of the ethanol-containing liquid diets.

Effects of chronic administration and subsequent withdrawal of ethanol-containing liquid diets on rat liver tryptophan pyrrolase and tyrosine aminotransferase activities and serum corticosterone concentration
We have previously shown (Bano et al., 1996Go) that chronic intake of the control liquid diet increases rat liver Trp pyrrolase activity, in comparison with activities in rats fed standard chow, and that the ability of chronic ethanol administration in the liquid diet to inhibit the enzyme activity [an effect repeatedly demonstrated by us previously after ethanol administration in drinking water (for references, see Bano et al., 1996)] depended on the dose of ethanol consumed and hence the ability of the drug to overcome the stimulation caused by the (control) liquid diet itself. Accordingly, the changes in activity of this enzyme in rats withdrawn from ethanol have in the present work (Table 1Go) been compared with values in the matched control group. As the results show, activity of the enzyme was indeed higher in the matched control, versus the solid chow, group, and was also moderately higher in the non-withdrawn (0 h) group, in comparison with the matched control group (by 32–55%). This latter modest elevation more likely reflects an early effect of withdrawal, rather than of chronic ethanol treatment, since the precise time of the last ethanol intake by this group may have been earlier than thought after removal of the ethanol-containing liquid diet. Pyrrolase activity continued to rise from 2 h onwards during withdrawal, reaching a maximum at 7–10 h, of 195–209% and 134–148% increases in the holoenzyme and total enzyme activities respectively. By 20 h after withdrawal, pyrrolase activities were still moderately elevated (by 23–41%). These data also show that the pyrrolase was almost fully saturated with its haem cofactor, since most of the activity was in the haem-containing holoenzyme form between 3 and 16 h.


View this table:
[in this window]
[in a new window]
 
Table 1. Effects of alcohol withdrawal on rat liver tryptophan pyrrolase and tyrosine aminotransferase activities and serum corticosterone concentration
 
As regards serum corticosterone concentration (Table 1Go), there was only a small elevation (14%) in the matched control, versus the solid chow control, group. In comparison with the matched control group, the 0 h non-withdrawn group showed an increase in serum corticosterone concentration of 32%. A dramatic elevation (100%) occurred rapidly (at 2 h after withdrawal), which was sustained up to 16 h after withdrawal (with relatively small peaks at 6, 10 and 16 h), before a return to near-normal values at 20 h.

The activity of another glucocorticoid-inducible liver enzyme, tyrosine aminotransferase, is also shown in Table 1Go. Although only the total enzyme activity is shown here (to try to correlate the total amount of the enzyme protein with glucocorticoid induction of expression of its mRNA), similar changes were also observed in activity of the pyridoxal 5'-phosphate-containing holoenzyme. As shown, activity of this enzyme was actually decreased by the control liquid diet by 38%, in comparison with the value in the solid chow control group. This decrease was overcome in the 0 h unwithdrawn group and was followed by an increase reaching a maximum value at 4 h. Tyrosine aminotransferase activity then followed an oscillatory pattern of elevation and decrease, with the activity being twice as high at 20 h as it was in the matched control group. Because, as stated above, the holoenzyme activity followed a pattern of change similar to that of the total enzyme, the saturation of tyrosine aminotransferase with its pyridoxal 5'-phosphate cofactor was not altered throughout the entire observation time-course (data not shown).

Effects of chronic administration and subsequent withdrawal of ethanol-containing liquid diets on rat liver tryptophan pyrrolase, tyrosine aminotransferase and glucocorticoid receptor mRNA expression
We have previously shown (Bano et al., 1996Go) that the control liquid diet increases the expression of rat liver Trp pyrrolase mRNA. This was also the case in the present work (Table 2Go), as the above expression (given as the ratio to the 28S ribosomal RNA internal standard) was 61% higher in the matched, in comparison with that in the solid chow, control group. Expression of Trp pyrrolase mRNA was not altered by chronic ethanol administration (in the unwithdrawn 0 h group) any differently from the matched control group (Table 2Go) and remained unaltered for the first 3 h after withdrawal of the ethanol-containing liquid diets. Expression was then increased by 40% at 4 h after withdrawal, remaining at broadly the same level for a further 5 h, before rising to a maximum (1.88-fold) at 10 h after withdrawal. It finally returned to control values by 16 h.


View this table:
[in this window]
[in a new window]
 
Table 2. ß-Actin, glucocorticoid receptor, tryptophan pyrrolase and tyrosine aminotransferase gene expression during alcohol withdrawal
 
By contrast with Trp pyrrolase mRNA expression, that of tyrosine aminotransferase mRNA was decreased by the control liquid diet by 46%. Using the solid chow control group as reference (Table 2Go), we found that chronic ethanol administration not only overcame the above decrease caused by the liquid diet, but actually increased the mRNA expression of this latter enzyme by nearly 60% above the control value in the solid chow group. After ethanol withdrawal, expression continued to rise steadily and reached a 2-fold maximum at 4 h after withdrawal, declining gradually to levels which were 50% lower than control values by 11 h. The time-course of increased expression of tyrosine aminotransferase mRNA after alcohol withdrawal thus appears 6–7 h shorter than that of Trp pyrrolase mRNA.

Expression of the hepatic glucocorticoid receptor mRNA is also shown in Table 2Go. The control liquid diet increased this expression by almost 4.5-fold. Chronic ethanol consumption in the liquid diet appeared to cause a decrease in this enhancement, which continued throughout the entire withdrawal period, with the exception of the 4 h interval, at which expression was dramatically increased by 66% above the liquid diet control value and by >7-fold the value in the solid chow control group.

As stated in the Materials and methods section, the ß-actin mRNA expression was decreased during our studies and could not therefore be used as reference for other gene expressions. The ß-actin changes are also shown in Table 2Go. The control liquid diet exerted no significant effect on the gene expression of this structural protein, but expression was significantly increased by chronic ethanol administration by about 30%. After 6 h of withdrawal, expression was decreased by up to 34% before a return to near-normal values at 20 h.

Summary of the effects of the control liquid diet and of chronic ethanol administration and its subsequent withdrawal and correlations between the behavioural and biochemical changes during withdrawal
A summary has been made (Table 3Go) to emphasize the differences between the effects of chronic ethanol administration and of subsequent withdrawal from those of the liquid diet itself and thus facilitate the elucidation of the possible relationship between the biochemical and behavioural changes observed during withdrawal. It is clear from Table 3Go that, although the control liquid diet exerted significant effects on almost all the biochemical parameters examined (in comparison with the solid chow diet), alcohol withdrawal elicited relatively much greater changes in these parameters (some of which in the opposite direction), which could not be attributed to either the control liquid diet or chronic ethanol administration.


View this table:
[in this window]
[in a new window]
 
Table 3. Summary of the effects of the control liquid diet and of chronic administration and subsequent withdrawal of ethanol-containing liquid diets on biochemical and behavioural parameters
 
A number of correlations have been estimated by regression analysis. The behaviour score during alcohol withdrawal was found to correlate strongly with the Trp pyrrolase holoenzyme activity, total enzyme activity, the percentage haem saturation and gene expression (r was 0.76, 0.71, 0.75 and 0.78 respectively). By contrast, behaviour correlated weakly with serum corticosterone concentration (r = 0.39) and negatively with the gene expressions of liver tyrosine aminotransferase (r = –0.62) and the glucocortcoid receptor (r = –0.46). Correlations were also observed between the glucocorticoid receptor mRNA and liver tyrosine aminotransferase activity and gene expression, and between serum corticosterone concentration and liver tyrosine aminotransferase activity (r = 0.56–0.64). Finally, gene expression and enzyme activity were correlated for Trp pyrrolase (r = 0.82) and tyrosine aminotransferase (r = 0.50).


    DISCUSSION
 TOP
 FOOTNOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
We have previously reported a dramatic activation of liver Trp pyrrolase and increased expression of its mRNA at 7 h after withdrawal of ethanol-containing liquid diets (Bano et al., 1996Go). The aim of the present study was to provide a more detailed examination, over an extended observation period, of these biochemical changes and of their possible relationship to the behavioural disturbances of the AWS. In studying the above changes, it is important to separate the effects of alcohol withdrawal from those of its chronic administration in the liquid diet and indeed any effects of the (control) liquid diet itself. As the summary in Table 3Go shows, this was an easy task, as withdrawal caused marked effects on the various parameters examined, which were either in the opposite direction to, or quantitatively much more pronounced than, those exerted by the control liquid diet or by chronic ethanol administration.

Effects of the control liquid diet
As regards these effects (summarized in Table 3Go), the moderate increases in rat liver Trp pyrrolase activity, the haem saturation of the enzyme and its mRNA expression shown in Tables 1 and 2GoGo confirm our previous findings (Bano et al., 1996Go). Although the control liquid diet did not cause remarkable changes in serum corticosterone concentration (Table 1Go), it induced a large increase in expression of the glucocorticoid receptor mRNA (Table 2Go). Surprisingly, the control liquid diet actually inhibited both the activity and gene expression of tyrosine aminotransferase, another glucocorticoid-inducible enzyme (Tables 1 and 2GoGo), despite the above increase in glucocorticoid receptor mRNA expression and in the absence of a decrease in circulating corticosterone concentration. The mechanisms of these effects of the control liquid diet clearly require investigation. It could, however, be stated here that the increase in the glucocorticoid receptor gene expression is unlikely to be the result of a general enhancement of mRNA synthesis, because levels of ß-actin mRNA in the matched control group were not significantly different from those of the solid chow group (Table 2Go). It is, however, clear from the above, and our previous (Bano et al., 1996Go), observations that, in studies in which ethanol is administered by this procedure, the potential effects of the liquid diet itself should always be investigated in comparison with a solid chow control group.

Effects of chronic ethanol administration in the liquid diet
As the summary in Table 3Go shows, chronic ethanol administration in the liquid diet did not exert effects differently from those of the control liquid diet as regards activity or gene expression of liver Trp pyrrolase. Ethanol, however, induced a relatively stronger increase in serum corticosterone concentration, but more remarkably lowered the large increase in the glucocorticoid receptor mRNA expression and overcame the decreases in liver tyrosine aminotransferase activity and mRNA expression caused by the control liquid diet. As stated in the Results section, it is not clear if these effects on the above non-Trp pyrrolase parameters could be attributed to chronic administration of ethanol or to its subsequent withdrawal, given the lack of information about the precise time the rats in the unwithdrawn (0 h) group actually stopped feeding. In any case, we can confidently state that, at least the effects observed during alcohol withdrawal are specific to this phase and therefore almost certainly unrelated to those of chronic ethanol intake. The effects of chronic ethanol administration on rat liver tyrosine aminotransferase activity and synthesis have been examined by Donohue et al. (1998), who found that neither parameter was altered in ethanol-treated rats, in comparison with pair-fed controls. This is in marked contrast with our present findings and no explanation can as yet be offered for these differences. Interestingly, however, the above authors found that tyrosine aminotransferase activity and synthesis were enhanced in pair-fed, in comparison with solid chow, controls, thus further emphasizing the importance of examining the effects of the liquid diet itself in studies using this method of chronic ethanol administration.

Effects of withdrawal of the ethanol-containing liquid diet
Ethanol withdrawal produced remarkable changes in most of the biochemical parameters examined (Table 3Go). The marked increase in liver Trp pyrrolase activity (Table 1Go) and gene expression (Table 2Go) confirm our previous observations made at 7 h after withdrawal of ethanol-containing liquid diets (Bano et al., 1996Go; Oretti et al., 1996Go) and extend them to establish that the maximum increases occur at 7–10 h after withdrawal, coinciding with the maximum score for the behavioural disturbances of the AWS (Fig. 1Go). Glucocorticoids are known transcriptional activators of the rat Trp pyrrolase gene (Nakamura et al., 1987Go), inducing the synthesis of the enzyme by stimulating its mRNA production (DeLap and Feigelson, 1978Go), and the increase in circulating corticosterone concentration during alcohol withdrawal observed in the present work (Table 1Go), which confirms previous observations (for references, see the Introduction), may therefore explain the increase in gene expression (Table 2Go) and hence activity (Table 1Go) of liver Trp pyrrolase. However, because hormonal induction of pyrrolase activity is not associated with increased saturation of the enzyme with its haem cofactor, unlike substrate- and cofactor-type activation, which are (see Badawy and Evans, 1975b), the increase in enzyme activity observed during alcohol withdrawal, which was associated with increased haem saturation (Table 1Go) must involve one of the above two mechanisms in addition to hormonal induction. As the release of catecholamines, which activate TP by a substrate-type mechanism (Badawy and Evans, 1976Go), is increased during alcohol withdrawal (see, e.g. Pohorecky et al., 1974), it is possible that they may be involved in the pyrrolase activation during withdrawal, a possibility that requires investigation. It was considered of interest to establish in the present work if the expression of the hepatic glucocorticoid receptor mRNA could be correlated with induction of Trp pyrrolase activity and mRNA expression and with circulating corticosterone concentration. As the results in Table 2Go show, glucocorticoid receptor mRNA expression, the dramatic increase in which exerted by the control liquid diet was strongly overcome by chronic ethanol administration, was increased sharply at 4 h after ethanol withdrawal. These changes in the glucocorticoid receptor gene expression, however, mirrored more closely those in activity and gene expression of another glucocorticoid-inducible enzyme, tyrosine aminotransferase, rather than in those of Trp pyrrolase.

Relationship between the biochemical and behavioural changes during alcohol withdrawal
The most striking finding of the present study was the temporal correlation between the severity of the withdrawal behaviour (Fig. 1Go) and changes in the activities and gene expression of liver Trp pyrrolase (Tables 1 and 2GoGo). The Trp pyrrolase changes were already significant at the time (2 h) at which the behavioural changes were beginning to appear, and both the behavioural and pyrrolase changes reached their peak values at 10 h after withdrawal before returning to normal or near-normal values by 20 h. By contrast, the behavioural changes correlated either weakly or negatively with those in the other biochemical parameters examined, which either reached their peaks at 4 h or fluctuated throughout the entire 20 h observation period. In any case, there is no likely obvious link between the withdrawal hyperexcitability and the metabolic consequences of changes in these latter parameters (e.g. decreased central catecholamine synthesis secondary to tyrosine aminotransferase induction, the effect of which is probably to induce hypoactivity), whereas in the case of Trp pyrrolase the possibility exists that its excitotoxic metabolite quinolinate, whose production is expected to be increased during alcohol withdrawal, may activate central NMDA receptors and thus precipitate the behavioural hyperexcitability of the AWS. Taken together, the present results and our previous preliminary data (Oretti et al., 1996Go) strongly implicate liver Trp pyrrolase and the metabolic consequences of its activation in the alcohol-withdrawal syndrome and suggest that further work addressing the potential role of these metabolic consequences may provide new insights into the mechanisms of alcohol dependence.


    ACKNOWLEDGEMENTS
 TOP
 FOOTNOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
We thank the Medical Research Council, the Mental Health Foundation and the British Council for their generous financial support. R.O. was an MRC Training Fellow and S.B. was a British Commonwealth Scholar when this work was undertaken.


    FOOTNOTES
 TOP
 FOOTNOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
* Author to whom correspondence should be addressed. Back

2 Present address: Princess of Wales Hospital, Bridgend CF31 1RQ, UK. Back

3 Present address: Department of Biochemistry, University of Karachi, Karachi 75270, Pakistan. Back

4 Present address: Institute of Psychiatry, De Crespigny Park, London SE5 8AF, UK. Back


    REFERENCES
 TOP
 FOOTNOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
Badawy, A. A.-B. (1977) Minireview: The functions and regulation of tryptophan pyrrolase. Life Sciences 21, 755–767.[Web of Science][Medline]

Badawy, A. A.-B. (1981) Heme utilization by rat liver tryptophan pyrrolase as a screening test for exacerbation of hepatic porphyrias by drugs. Journal of Pharmacological Methods 6, 77–85.[Web of Science][Medline]

Badawy, A. A.-B. and Aliyu, S. U. (1984) Antagonism of acute alcohol intoxication by naloxone. Alcohol and Alcoholism 19, 199–201.[Abstract/Free Full Text]

Badawy, A. A.-B. and Evans, M. (1973) Tryptophan pyrrolase in ethanol administration and withdrawal. Advances in Experimental Medicine and Biology 35, 105–123.

Badawy, A. A.-B. and Evans, M. (1975a) The effects of ethanol on tryptophan pyrrolase activity and their comparison with those of phenobarbitone and morphine. Advances in Experimental Medicine and Biology 59, 229–251.[Medline]

Badawy, A. A.-B. and Evans, M. (1975b) The regulation of rat liver tryptophan pyrrolase by its cofactor haem—experiments with haematin and 5-aminolaevulinate and comparison with the substrate and hormonal mechanisms. Biochemical Journal 150, 511–520.[Web of Science][Medline]

Badawy, A. A.-B. and Evans, M. (1976) The role of free serum tryptophan in the biphasic effect of acute ethanol administration on the concentrations of rat brain tryptophan, 5-hydroxytryptamine and 5-hydroxyindol-3-ylacetic acid. Biochemical Journal 160, 315–324.[Web of Science][Medline]

Badawy, A. A.-B., Snape, B. M. and Evans, M. (1980a) Biphasic effect of acute ethanol administration on rat liver tyrosine-2-oxoglutarate aminotransferase activity. Biochemical Journal 186, 755–761.[Web of Science][Medline]

Badawy, A. A.-B., Punjani, N. F., Evans, C. M. and Evans, M. (1980b) Inhibition of rat brain tryptophan metabolism by ethanol withdrawal and possible involvement of the enhanced liver tryptophan pyrrolase activity. Biochemical Journal 192, 449–455.[Web of Science][Medline]

Badawy, A. A.-B., Morgan, C. J. and Davis, N. R. (1983) Determination of tryptophan pyrrolase activity in rat liver homogenates. Biochemical Journal 215, 709–710.[Web of Science][Medline]

Ballenger, J. C. and Post, R. M. (1978) Kindling as a model for alcohol withdrawal syndromes. British Journal of Psychiatry 133, 1–14.[Abstract/Free Full Text]

Bano, S., Oretti, R. G., Morgan, C. J., Badawy, A. A.-B., Buckland, P. and McGuffin, P. (1996) Effects of chronic administration and subsequent withdrawal of ethanol-containing liquid diet on rat liver tryptophan pyrrolase and tryptophan metabolism. Alcohol and Alcoholism 31, 205–215.[Abstract/Free Full Text]

DeLap, L. and Feigelson, P. (1978) Effect of cycloheximide on the induction of tryptophan oxygenase mRNA by hydrocortisone in vivo. Biochemical and Biophysical Research Communications 82, 142–149.[Web of Science][Medline]

Donohue, T. M., Jr, Drey, M. L. and Zetterman, R. K. (1998) Contrasting effects of acute and chronic ethanol administration on rat liver tyrosine aminotransferase. Alcohol 15, 141–146.[Web of Science][Medline]

Freund, G. (1970) Alcohol consumption and its circadian distribution in mice. Journal of Nutrition 100, 30–36.

Glick, D., Von Redlich, D. and Levine, S. (1964) Fluorimetric determination of corticosterone and cortisol in 0.02–0.05 millilitres of plasma or submilligram samples of adrenal tissue. Endocrinology 74, 653–655.

Gonzales, R. A. (1990) NMDA receptors excite alcohol research. Trends in Pharmacological Sciences 11, 137–139.[Medline]

Haber, R., Besette, D., Hulihan-Giblin, B., Durcan, M. J. and Golman, D. (1993) Identification of tryptophan 2,3-dioxygenase mRNA in rodent brain. Journal of Neurochemistry 60, 1159–1162.[Web of Science][Medline]

Hadjiolov, A. A., Georgiev, O. I., Nosikov, V. V. and Yavachev, L. P. (1984) Primary and secondary structure of rat 28s ribosomal RNA. Nucleic Acids Research 12, 3677–3693.[Abstract/Free Full Text]

Hunter, B. E., Riley, J. N., Walker, D. W. and Freund, G. (1975) Ethanol dependence in the rat: A parametric analysis. Pharmacology, Biochemistry and Behavior 3, 619–629.[Web of Science][Medline]

Leeuw, W. J. F., Slagboom, P. E. and Vijg, J. (1989) Quantitative comparison of mRNA levels in mammalian tissues: 28s ribosomal RNA levels as an accurate internal control. Nucleic Acids Research 17, 10137–10138.[Free Full Text]

Lieber, C. S., DeCarli, L. M. and Sorrell, M. F. (1989) Experimental methods of ethanol administration. Hepatology 10, 501–510.[Web of Science][Medline]

Lovinger, D. M. (1995) Ethanol and the NMDA receptor: implications for intoxication, tolerance, dependence and alcoholic brain damage. In Acamprosate in Relapse Prevention in Alcoholism, Soyka, M. ed., pp. 1–26. Springer, Berlin.

Macey, D. J., Schulteis, G., Heinrichs, S. C. and Koob, G. F. (1996) Time-dependent quantifiable withdrawal from ethanol in the rat: effect of method of dependence induction. Alcohol 13, 163–170.[Web of Science][Medline]

Miesfeld, R., Rusconi, S., Godowski, P. J., Maler, B. A., Okret, A., Wikstrom, A.-C., Gustafsson, J. A. and Yamamoto, K. R. (1986) Genetic complementation of a glucocorticoid receptor deficiency by expression of cloned receptor cDNA. Cell 46, 389–399.[Web of Science][Medline]

Morgan, P. F. (1991) Is quinolinic acid an endogenous excitotoxin in alcohol withdrawal? Medical Hypotheses 36, 118–121.[Web of Science][Medline]

Nakamura, T., Niimi, S., Nawa, K., Noda, C., Ichihara, A., Takagi, Y., Anai, M. and Sakaki,Y. (1987) Multihormonal regulation of transcription of the tryptophan 2,3-dioxygenase gene in primary cultures of adult rat hepatocytes with special reference to the presence of a transcriptional protein mediating the action of glucocorticoids. Journal of Biological Chemistry 262, 727–733.[Abstract/Free Full Text]

Nudel, U., Zakut, R., Shani, M., Neuman, S., Levy, Z. and Yaffe, D. (1983) The nucleotide sequence of the rat cytoplasmic beta-actin gene. Nucleic Acids Research 11, 1759–1771.[Abstract/Free Full Text]

Oretti, R., Bano, S., Morgan, C. J., Badawy, A. A.-B., Bonner, A., Buckland, P. and McGuffin, P. (1996) Prevention by cycloheximide of the audiogenic seizures and tryptophan metabolic disturbances of ethanol withdrawal in rats. Alcohol and Alcoholism 31, 243–247.[Abstract/Free Full Text]

Pohorecky, L. A., Jaffe, L. S. and Berkeley, H. A. (1974) Ethanol withdrawal in the rat: Involvement of noradrenergic neurons. Life Sciences 15, 427–437.[Web of Science][Medline]

Rettenmeier, R., Natt, E., Zentgraf, H. and Schere, G. (1990) Isolation and characterization of the human tyrosine aminotransferase gene. Nucleic Acids Research 18, 3853–3861.[Abstract/Free Full Text]

Shaw, G. K. (1995) Detoxification: the use of benzodiazepines. Alcohol and Alcoholism 30, 771–774.[Abstract/Free Full Text]

Sigma Chemical Company (1982) Sigma Technical Bulletin No. 332-UV.

Stone, T. W. (1993) Neuropharmacology of quinolinic and kynurenic acids. Pharmacological Reviews 45, 309–385.[Abstract]

Watson, W. P. and Little, H. J. (1995) Identification of distinct components, with different time courses, of the changes in response to convulsive stimuli during ethanol withdrawal. Journal of Phamacology and Experimental Therapeutics 272, 876–884.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (2)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Oretti, R. G.
Right arrow Articles by Buckland, P. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oretti, R. G.
Right arrow Articles by Buckland, P. R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?